GenePrediction:GLEAN_5815 Details

Name: GLEAN_5815
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:769446..768840 (- strand)
Length: 607
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:769446..769327 (- strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_173:769222..769144 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_173:769069..768999 (- strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_173:768938..768840 (- strand)
Length: 99
>GLEAN_5815 class=GenePrediction position=GCSC_173:769446..768840 (- strand)
ATGGCCGACGTTGATATGGCTGATGCTCCACCCTCTGAGACCATCGTCAAGAAAAAGACTGTCTCTTCGGCTGATGCTGG
AAAGGCTGTGGAGCTCAGGAAACGATTCGAAGTAAAAAAGGTGCGCCAGTTCAGTATACAATAACTTTGTTTGCCTCTCG
GCCGGACAGACTGGTTGCTGGAGCGCACGCTGCGCCGGAGCTGACAAGGCATGGAAACTCATAGTGGAACGCCGTTGCCT
TGTGGGCATGGGACATTGTCGTTGATAACTGCGCCATCTGCAGAAATCACATCATGGACTTATGTAAGTCGACCGCCTCT
TGTTTTAACACATGTTTTGCATACAGTAACTGACGAGGCTTTTTCACACTATCACAGGCATAGAATGTCAAGCAAATCAG
TCTTCGGCCACGAGCGAAGAATGCACTGTTGCCTGGGGCATTTGTAACGTGAGTTTTCCCTTGTTTGTGACCTATCGCAC
TGGCTGTCGTCGCTTACTGTAATTATAGCACGCCTTCCACTTCCACTGCATCTCGAGGTGGCTCAAGGCACGCCAGGTGT
GCCCTCTTGACAACCGCGATTGGGAGTTCCAGAAGTATGGTCGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62