GenePrediction:GLEAN_5816 Details

Name: GLEAN_5816
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:766295..764352 (- strand)
Length: 1944
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:766295..764998 (- strand)
Length: 1298
Type: CDS
Source: GLEAN
Position: GCSC_173:764931..764352 (- strand)
Length: 580
>GLEAN_5816 class=GenePrediction position=GCSC_173:766295..764352 (- strand)
ATGTCGGACCACGAAGAAGAAACCGGCATGGATACTGGGTATGACACCCCTGTCCCGGAGCTGGACGACCACCGCAACCG
GCTGCCAACCACACAGCGAACTGAGCGGCCTCGCCGCGGCACCTTCGACTCTCTATATGGACAGCATATGGAGCATGGAA
CTCGCCTTTCCTCTGATCACCAGGCCGGCGTACGTGTTCGTGACTTTGAAGAGGCCGTGGATGACGGTGATGCCCCAGAG
GACTTACATGAGGCCATCGGCTCTCGCCGTCTTACCTCTGGAACTGTGCGCACGGAATCTCCGCCAAACTCTGTTAAGGC
TTTTGCGGAGGCTCGTCGCCGGGAGCGTGACATGTCCTTCTCTGAGCAGAAGCCCGAGAAAGACGATAATGTTGAACCAC
CTCACCTTCAGAGGGTGGCTTCGGTTGCAAGCCGCCGCAGCCTTCGCAGCCGCGCTCATACCGTGGACAATGATGCGTCT
AGTATGGCGTCTACCAACTCTGCAGAGGAGGACGTCTGCTTTCCCGTTTCCGACGAGCATCGGCGTGACCAGCTCCGCAT
CGACTATGCCTATCTCGAATCATTCATGCAAGAAGAAAGGGAAGAACGTGAGGAGGCTCGTCGGGACCTGGAAGCCCGCA
CTTTTCCCGACCTCCGGCCCCAGATTTCTGCAACTGATTCGATGAATCCTCCGCCGATGGTCACCTCCGACGGCGACTTT
GTTGGTGCCACAGCCGGATCCACCATCGAGTATGAGAAGGAGCAAGCTGCCATCAAGGCAGAACACCAGCTGCCTGCAAA
GCCGGTCCAACATGTCGACCCAAACCGGTTCAGCTTTTTCTCCTCAGCCTGGGAGTCTACCATCCATGCCGCGGACTTTT
CAGACCTTGTGCTTCCCGGAGAGTCCGTCCGTGGCCTGTTCACCTTCCCAGAGGGTGAAAGTGACGGGGTCTGGTGGTTA
AACGTCAACAGTCCGACCGAGGACGAGGCGCGAGCCATTTGTCGTGCTTTTGGCATCCACCCCCTCACCAGTGAGGATAT
CACCCAACAGGAAACGCGCGAGAAGATTGAGATCTTCCCTTCTTACTACTTCGCGAGCTTCCGGTCTTTCAACATTGTCA
AGGATGAAGATGGCGAGATAGAGTATGAGCCTTTCCATACGTACGTCGTCGTCTTCCGTGAGGGCACTCTCAGCTTCAGC
TTTGCACCCAACACGCACGCGTCGAAGGTGCGGACCCGTATCGCCCTGCTGAAGGATTACGTTGCGTTGAGCAGCGACTG
GATTTGTTACGCTTTGATGTAAGACTGTCCATATCAACTGCCCCGTTGTTTTGACCGAGTGCATCTACTGACATTGGCTT
CTAGCGACGACATTGTGGATTCATTTGCTCCCACCATTCACGAAACTGAGATGCAAACTGAGAGACTTGAAGATGAGGTG
TTCGTTGCGCGAACAGACGACATGCACGACTTTCTTCGGAAGATTGGCAACACCCGCAAGAACGTCATGGGCTTGATGCG
GCTGCTCGGTGGCAAGGCTGATGTTCTGCGTGGCTTTACGAAGCGCTGCAATGAGAATTACAACGTGACGCCACGCATGG
ACATCGGCATGTACCTGGGTGACATCCAAGACCACGTCGTCACGATGATGAACAACTTGATGCACTGCGAGAAGATGCTG
TCCCGCACCCATAGCAACTACCTTGCTCAGCTATCCATCGACAGCATTTCGCAGGGCACAAACACCAACCGGGTTCTCAG
CAAGATCACCTTCATTGCGTCCATCATTGTTCCCCTGAATGTTGTTACTGGCCTGTTTGGTATGAACGTCGCGGTCCCAT
TCAACAAAGTTGAAAACCTTCACGCCTTTACTACTATTGTTGTGTCTCTGGTTGGATTCTGTATCGTTTCCCTGGTTGTG
GCGCGACGTATGAGATATATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62