GenePrediction:GLEAN_5819 Details

Name: GLEAN_5819
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:756053..754906 (- strand)
Length: 1148
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:756053..755737 (- strand)
Length: 317
Type: CDS
Source: GLEAN
Position: GCSC_173:755295..755060 (- strand)
Length: 236
Type: CDS
Source: GLEAN
Position: GCSC_173:754994..754906 (- strand)
Length: 89
>GLEAN_5819 class=GenePrediction position=GCSC_173:756053..754906 (- strand)
ATGGAGGACAAACATCCCGCATCTCAAGATGTCAATACGACCATGTGGTTTCTGAAGGAGAAGGTGCTCTACACGACTGT
GAAGCCGTACTGTCTTGCCTTCACTCCGGAAACCGATGTCCCTCGAGACAACATAGAGCGACACGAAGTGCCCGTGGGCG
TCCTGGATATACGGGGCAGACGGGAACCTCTCAACTTTCATCACAATGGCTTCGCAATCTTGAACGTTCCCGAAGTCCCG
ACTGGGATGGATTGGTATGACGTGCAGAGCGTTAAGGGCCTACGCTATCCGCAGATTGTGTCGGAGATTGAAAGGGTGTT
TCCTGGAGGCCGCTGCATACCTCTTTCTCACAAGGCAAGTACTCGAGCTCGCATCTCGAATCTCTTGTCATCCTCGTGAT
CCTAGCACATATCTAATGGTGCTCTTCCTGCTCAAGATCCGAAAGCGGGACGCTTCTTTTCCAATTTCGAGTGGAAGCGA
CTATGAATATGCACAGCCTCTTATAGCCGCGCATGTTGGTGAGACATCTGCCTCCAATAGAGGAGAACCCGCCGTGCGAC
TGTCTGGTCTGCTTACCCTTGACGCCAGATATGACTCGATCTACGGCGGAGCAGTTGCTTCAGGAGCGCCCAAACATAGC
GGACCTCGACATATTTCATCGCAGATACATAATCGCAAAGTGCGTCGCTCGTTTCCGTCTTTTCTTCCTTTCATTTTATT
TTATTTTTTGGAAGCCCGTTACCAACTGAAGGTGTCAGCGTATGGCATCCTATCAAGGGCCCAAACCAGGATTGGCCGCT
GGCCCTCTGCGATCTGTCCACCGTGAACTCGGACAAGGACCTTGAGATAGCAGACTACGTGACGCCCAAGAGAAGTCGAG
AGCACTGCATGGTCTATTTCCGCAATCACCACCGCTGGTGGTACATGAGCCGCCAGAGAGTCACGGAAGCATTGCTGTTC
CGCCAGCACGACTCGGAACAAGGCGATAAATCAGGTATGATATGGCAGTGCTACACAGACTACCGCTGCGGTATTGGTTC
TAATATTAGGCCCTCCTAGGTGTTCCGCATGCTGCCTTCTTCAACCCGTACGCCGAGCTAGAGATGCCACGGGAAAGTAT
GGAAACCACTGTACTCATCTATTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62