GenePrediction:GLEAN_5820 Details

Name: GLEAN_5820
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:751357..748507 (- strand)
Length: 2851
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:751357..750677 (- strand)
Length: 681
Type: CDS
Source: GLEAN
Position: GCSC_173:750584..749930 (- strand)
Length: 655
Type: CDS
Source: GLEAN
Position: GCSC_173:749874..749419 (- strand)
Length: 456
Type: CDS
Source: GLEAN
Position: GCSC_173:749347..749310 (- strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_173:749150..749104 (- strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_173:749035..748507 (- strand)
Length: 529
>GLEAN_5820 class=GenePrediction position=GCSC_173:751357..748507 (- strand)
ATGGATGCTCATTTCGTGACCGTGCCAGATGGCAGTCTCTCTCCTTCCTCAACTGCGGACGCCCTCACGCTGCGCGCAAC
AGCATGCGCCATTCTCCTAGGCTTCGGCGTCTGTCTCGCCAACATGTATTTCGGGCTGCAGGCTGGTATGGTGAATGCGA
TGCCGATGCAGAGTGCTCTGCTGGGCTTTGCCCTCTTTCGGAGCATTCAGCACCGTCTTCGTACGCCCCTGTCGCCGATG
GAGACCACAGTAATGGAGATCGTCTCGGGAGCGCTAGGACTCGCGCCGTTCACAACTGGCTTCACGTCCTTCATTCCCGC
TCTAGAGTTCCTCACTACTCCGGATGAGCATGGTCCGGCCACACGATTCAGCACCGGTCAGCTTCTCCTCTGGTCTACCG
CCATGTGCGGACTGGGCATCGTTTCCGGAGCGCCCTTTCGAAACCTCTTCATAAAGCGCGAGCGTCTTAGGTATCCCTCG
GCCACGGCCACGGCCACCTTGATCGGCGTGCTTTTCCGGCGAGAAGACATTGTAGCCAGGGCTGGACCCTCAGAGACGGA
CAACAATACTACTGTTTCGGTTGCTACTGCTTCCGTACCCTTGGTCTCACACCCTGACTTAGACAGCAACCAACCCGCCA
TAGCGGCTCTCCTATGGTCTTTAGCCGGGTCCTTTGTGTTTGTAAGCCCTCTACCCCTCCTACCTTCAGATATCGTCTGT
GTTGCTTACACAGAGAGCAGAGTCTTATAGCGTTCTTCTTGCCAATATTGAAGTGTGTGCCTATCTTTGGCACCCCGGCC
GCTCGAGACTGGTTCTGGGCCTTTGATCTTTCTCCTGCCTACATCGGCTATGGCATTATTATCGGACCTACTATCAACGT
CTACATGCTTTTGGGTGCTGTTATTGGCTGGGGGATTCTGTCGCCGGTAGCTAAAAACAACGGATGGGCTCCGGGCCCGG
TTGGAGACTGGGAAACAGGCTCACGTGGGTGGATTCTCTGGACTGGCATGGGCCTGATTCTTGGCGACACGTTTATAGGA
CTAAGCTGGACTGGCGTGTGGCCCCTGCTTTCCCTCCTGCTGTCCCACACTCGACAGACGCTAAGCAGGCGCCTAACAGA
GGAAGAAGCGCCGCTGATCCTCAACGATCCAGATCTACATGTGCATGTACTGTCCAGCTCTGGCATCGGCACTCGTACCG
CTGACCCAGCGGATGACGACTGGGCCGACTCTTCTCTTGTCACGAATGTGCTCTTGCTTTGGGCGGCATCCGGTATTGTA
ATTTTGTTTTTAGTGTCTGTGCTAGTCGCATTCCAGGACTTGGTTCCCGTGCTGGCGACTCTCGTCGCGGCAGCCTTTCT
CCCCCTCGCTGGCGTCATATCCATGCGCTCGCTGGGAGAGACTGACAACGGAGCAGGCTTAGCTATCGGTAAGACGCAAG
TCCCTTCGTTGATTTCATGAGCTGACAGTATGGGGTGTGGCAGGGAGACTGGCGCAGTTTATGATCGCGCTGCTCGTCCG
TCCGTCCAGCCAGCACTACACAACGGCGAATCTGCTCCTAGGCGGCGCCATTGAATCCGGAGCGTCACAGGCGTCGCAGC
ACATGGGCGGCCTCAAGACAGCATACATGACCCAGACACCCCCGAGGGCAGTCTTCTACGGTCAGATGATTGGCTCCTAT
GCAGGAGCTCTCGCGGCAACTGGTCTTTACCGGATGTACACGTCTACGAACACGATACCGAGCGAAGAGTTCGGCGTGCC
AGACGCGCATCTCTACATGGTGGCGTCGCGGTTCATTCGCCAGCAAGGCTTGCCCCCTGGCGCAATGGGCTTCACCGTGG
GGGCGTTTGTTCTCGGCGCGGTGATGAGCATGCTGAGGATATTAGGTTCCAAATACTGGTGGAGACGATTCGTCCCATCG
GGCGTGGCCGTGGCAATAGGTAAAAGGATCCGTTGGGTGTGTAGAGAATACGACGACTAGCATGACCGACAAGCTAATAT
GTGCTTATAGGAATGCACATCATGCCAGCCATAACACTGCCTCGAGTCGTAGGAGGACTGGTCTTTTTCATCGGACAGCG
ACAGTTTCACTTCGATAAATTTACCCTATTGTGTTGCGCTACCGGTCTCATTCTCGGACAGGGGCTGTTCAGCTTGGTCA
GCCTAATGCATGCTGTACTGGAAGTGCCAGCTGTTGTGATACCGTAGGCAATGATACGGCGAATTGTGGCTCGTGAAGCA
CGCGTGAAGCACGGGTAGAGTGTGAGCAAAAGGGAAACCTGATGGCAATTCAGACATCTCGGGTATTTCAAGGACCTTAA
AGAGATCTTCACAACGGCTTCAGAATGGACAGATACACGCTGCGGCTCGACACCAACTTTGTGCCGGGGCGCCAGGCCCC
CGGGGACCTCGGTTCTGAGATCGGACCAGTGCAGCTCGAGGACGGCAGCACGGTCGATGGCGGACACGTCCTGATGCGCG
GACAGTGGAACGTAGCGTTTGATCGGCGTCTCGTCGCGGCCGCCCGGCCAGAGGATATCTGGGTCTCCAAAAACCGACAC
TCGGGATTTTGGGGCGGAACAGGCATCGAGGCCGCGCTCAAGAGCCGCGGCATTCGCACGCTCTTCTTCTCGGGCGCCAA
TATGGACCAGTGCGTCGCCACGTCCGCCATCGATGCCTACGCTCACGGCTGGGACTGCCTGCTGCTGAGCGATGCCTGTG
CCACGACAAGCCCCGACTTTGCCCGCCAGTGCGTTGAGTTTGAGTGCGCCGTCGGCTGGGGCTTCGTCCTGACCTGTCAG
CAGTTGGCTGACGGCATCGACAACATACAGACGGCAGTGCCAGATTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62