GenePrediction:GLEAN_5821 Details

Name: GLEAN_5821
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:747015..745914 (- strand)
Length: 1102
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:747015..747007 (- strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_173:746576..745914 (- strand)
Length: 663
>GLEAN_5821 class=GenePrediction position=GCSC_173:747015..745914 (- strand)
ATGCAGAGGGTACGGTTTGCCCAATATCGTTTGTCAAGGACATACTCGTAAGACTCTGCTCTGTCTGTTATCTGTATCCT
TTGCTTTCGCTTTCTCTTTGTCCGTCCAACCTCGGCCTTTACTCCACCCACCATATCTCCTCTCATCGTGCGTCAGATCG
TCACATCAAGCGCAAATTGATATCTCACCCCTGGTCGGTTATGGCGCTACCCAGCCTTAGTCGTGCTTGGAGTAAGCTCT
GTCCCAAGACACTTTTTCTGAAGGGGGGTTAAACATATGGTACCATGTGTTATCGCTTGATTTTCATACCCTCGTGGGAC
ATGCGGATATACGGTCGTTTTAAGTGATACAACCAGTTTCCTACTACATCCTATAAAAAGCCACACTTCTGCTGCGTCCA
GACTATTGACTGCTATCTCAATCCCCCTTGCCTCTGCAGTACCCATACGCCCTACGTGTCCTGCCCGAGACACTCGCATC
TAAATGGGAGAGCCCATCGTTTGCTCCATACCGCGACGCCTTTCCTGCCGAATACCGTGCCTCGCCTGCCGCCCTGACCG
CCCACGTACACGACCTCGTTGCCGGCGACATCAAGGCCCCATACCTTAAGAGTCTCCAGGGCCTTCTGTGGAAAGATGGC
TATCTCAGTGGTGCGTTGAAAGCACCGCTCTTTGCCGACGTCACGCCTCGCTTGACCGACTGGCACAAGGCCGGCATCGC
TCTCGTCATATACTCGTCCGGCTCTGTGCCCGCTCAAAAGCTGTTGTTCCAGCACACGGGCGTGGTGGGTGGCAATAATG
ATGGCAATGGTTCTGGCACGGATGTAACCCCTCTCCTGAGTGGCTACTACGACACCATCAACGCCGGCCCCAAGACTGTC
GCCGCCAGCTACTCAGCCATCCTGGCCCAACAGGAATTGCCACATGCAGACATATCCCCCGATAGCTGGCTATTCCTGAG
CGACAATGTGTTGGAGGTGGAGGCAGCACACGCAGCTGGTCTGCAAAGCTACTTGGTGCAGAGGCCTGGAAATGCACCGC
TGGCAGCGGATATAGCAAAGAAGCATCGGGTCATTGCCAGCTTTGATGAGATCGACCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62