GenePrediction:GLEAN_5824 Details

Name: GLEAN_5824
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:735639..733086 (- strand)
Length: 2554
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:735639..735362 (- strand)
Length: 278
Type: CDS
Source: GLEAN
Position: GCSC_173:735262..734019 (- strand)
Length: 1244
Type: CDS
Source: GLEAN
Position: GCSC_173:733962..733802 (- strand)
Length: 161
Type: CDS
Source: GLEAN
Position: GCSC_173:733744..733679 (- strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_173:733619..733086 (- strand)
Length: 534
>GLEAN_5824 class=GenePrediction position=GCSC_173:735639..733086 (- strand)
ATGGCCCCGGCCGACGCGTCCAATACGTCCAGCGGAAACGATGCGGCGGCCATGACGGACGATAACAGCCAAGCGCACGC
GGCGGCTTCTCTGCAGCGCAACGACAGCGTATCGTCAGCCGGCTTCTACTTCCAGGGCGTGCAGTTCGCACCCGACGGCG
ACGGCGATGGCGACGACTCATCTCGGCTGCTGGACGACGGCCAGCGTGATCCTTTCGACGACGGTGATGTGGGCAGCCGG
AGAGGGGCAGGAGAGTGGCCTCCCTTGAGGCGGCGAAGGTGAGCTTCCATCTTCTTTTCTGCTGTCTCTCTCTCTCCACC
AGAGCACGTGAGCACGTGAGCAGCCTTTGGGAGCATGCACTGACTGGTATTTCGCAGGTCGTCCATTGGAGCACGCCTCG
CCGCCCTGACCGAGATTGGAGGTGTCAACAGCATCCGCTCGTTCACCCGGAGCTGGCAGCGTGCGGCTGGCTTCACCGAG
GTCATACCGCAGCCGCCGTCGTTTGTCTTTGCCGCCGATCAAGAGCCGATATTCGGCGCTCCGAACTCCGAGGCGTACGG
CCGCAGCTTTGTCGACGAGGAAGCTGTGGGGACACCATTGACGTCCGATAACACCCTGCCTTCGGCTGCGCCGTCCGAAC
CGGGTGGCAGTAATCTGGCTACGGACCAACAGGACGGCCTGGATGATGCAGAGAATGCGGAGCACAAGAGCCTGCTCGGG
TCATCCGGGCTGACGCGTGCGTTTCGAGCTGGCAGCACGTCGTCCATCTTTGGGTATCCGCCGCATCTGGCATCCGCTGC
GGTGGGGGGTGCTGGCCTCCTGGGCACATCTCCTGTCATTGGCAGCTATGGGTCGCCCGGGTCGTACCGGTCGTATCGGT
CATATCCGTACGGCTCTGTCAGCTCGGCAGCCGGCCTGACGTACGACACCATGACCGGCCGCCGCGGCAGCGGCTTGGCG
TCTGGATCAATGACCCAAGCGGGGTCGCTGTGGCGGCGGCAACAGCAGCATCAGCATCAGCATCAGCATCAGCATCAGCC
GGGCCCGGAGGTAGAGGAAGTGGAAGCTATTGGCGAAGACGTCGGACTGATAGCGACCCTTGACGAGCGGCCGGCCATCC
TGGTCAAAGAGGTCGAGGAGGACGGCAAGATCATCCTGACGGTCGAGGGCCAGTCTACGCTGCCGCAGACCATCTTCAAC
TCGATCAATGTTCTGATTGGCGTGGGGCTGCTGAGTCTGCCGATGGGCATCCGGTATGCTGGCTGGATCTGCGGCATGAC
GACGCTGCTGATGGCGGCTGTCGTCACGGCCTACACGGCGCGGCTGCTGGCCAAGTGCATGGACCTGGACCCGGTCGTCA
TCACCTTCTCAGACCTGGCGTTTATCTCGTTTGGCCCGCGGGCGCGCGTGATGACCAGTCTGCTGTTCACAGTGGAGCTG
ATGGCGGCGTGTGTGGCGCTTGTCGTGCTCTTCGCCGACTCGCTGGGCCTGCTGTTCCCGGGCTTGCTGACAGCGCTCGA
GTGGAAGGCTCTCTGCTGTGTGATCATGATACCCCTGAACTTTCTTCCGATGCGGTTGCTGAGTGTGACCAGCATCATCG
GCATCGTCTGTTGTTTTAGCAGTGAGTGAGATGCTTTTCCGTTGTTCGCTCTAGATGCTGACAGGATCTCCGTGCAGTTG
TCTCCATTGTCGTCATTGACGGCTTCACCAAGAAGACGTCGCCCGGCTCGCTGCTGCAGCCGGCGGCTACGTACATGTTC
CCGGCCAACTGGCTGACGCTGCCGCTGTCGTTTGGCCTTCTCATGTCGCCCTGGGGCGGCCACAGCGTGTTTCCAAATGT
GAGAGCGTGCTGTGCATAGAAGCGTGTGTGCGTCGTGCTGACTGGTCTGTGACAGATCTACCGTGACATGCGACATCCAG
CCAAGTATGCCAAGGCCGTGAAGGTGACGTTTTCGTTTACTGTAAGTTGGCCATTTCCTCCTGCAAGCCCCACGCGAGCT
TTCACTGATGCGGCTGTCAGTACTTTCTGGACGTCACGACGGCTGTGGTTGGACTGCTCATGTTTGGTGACGATGTCATG
GACGAGATCACAGCCAACATTCTGTCAACATCCGGGTATCCACGGGCGCTTACGCTTCTTCTCTGTGTCATGATCGCCAT
CATCCCGCTGACCAAGATTCCACTCAATGCACGACCCATCATCACGACGATCGAGGTACTGGCGGGCACGCATCAACAGG
TGGCGGCCGATGCGCCAGGACAGGTCGGCCGGACCATTGTCAAGGTGGCCATCCGCGTGCTGACGATCCTGTCCTTCTTT
GCCATTTCGGTCGTCTTTCCGGCTTTCGACAGCATCATGGCCTTTATGGGCAGCGCGCTATGCTTCACGATCTGCGTCAC
TTTGCCGATATTGTTTCATCTGAAGCTCTTTGGTAACAGTCTGTCGGGCAGAGACAAGGTGCTCCAGTATGCCATGCTGT
CGCTGTCGATCGTGCTCTCGGTCGTGGGCACAGTCTGGTCATTCCTGCCGAAGAGTCTTTTGGGTGTGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62