GenePrediction:GLEAN_5826 Details

Name: GLEAN_5826
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:721184..720138 (- strand)
Length: 1047
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:721184..720935 (- strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_173:720864..720739 (- strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_173:720646..720413 (- strand)
Length: 234
Type: CDS
Source: GLEAN
Position: GCSC_173:720337..720138 (- strand)
Length: 200
>GLEAN_5826 class=GenePrediction position=GCSC_173:721184..720138 (- strand)
ATGCCTAAGCTTTACCACTCAGTCCCTCTCGATGAGGAGAAGGATGGAGCATCATTCAGCCGTACATTAAGCAGCGACTC
AGACTGGGATGGCGTCATTCCTAAAGCCCGCCGTCAACTTAGCAGCCACTGGTCTTGGCTGATCCATGCCGTGCTGCTCA
CCGTCTCCGGCACACTCTTCGCCGTCTCTTTCTGCGCACGCACTGCAAAGCCAGACGATACCTTGTACACAAAACTGTAC
TCGTCGTACTGTGAGCTCATTCCGCCCATCTGCGGTACACAATTTCTGTGAAATCTGCCTCTAATATTCTGCTCTCACAG
CCCCCGCCGCGAATGTGGTCAAGTATGAGACTACCCGGTTCACCAACCTGACACCCGTCGTGGAAGGCCCTTTTGTAGGC
TACGGGCCTGAAGTTGACCTGGCATGGGATTATATTGCAAATGACAGTACGTATTGCCCAAACAATAAAGCTAATCTGGG
TGAGGGGTGGACCAAGCGTATGTATGCCGAACAATTACTAACCAATGGAATGAAACAGTCGGTGATACGATGATCTCGGA
GAAAGAGCTCGACGACCTCGGACTTCCACGAAACTCGCTAAAGATCGCCCACCCAAAGACCGGAGAGGTCGGCTACCGGG
CCGCACTGGAAGTCTTTCACCAGCTCCACTGTCTAAACCTGGTTCGGCAGGCTGTGTACAAGGATTACTATAAGGAGCAC
GGAGGTGACGTTGGCGAGGCGGAGAGCAAAGAGGACCTGATGGGACATGTCGGTAAGCAGATCAGAGGCCGACGAAGCCG
AAAACGGTCCTCTTCTAAGAAAGAGTCCGCGCTAACAGAAAGTCCAGACCATTGCATTGAGACGCTGCGGACAAATCTCA
TGTGCCAGAGCGACATTGGCGTCTTCACCTTCAAGCTGTTCCCCGAGTACGGCTTTCCTGATGACGACTACTGGCCCGAC
TTCAACACTCTGCATACGTGTCGTAACTTCGAAGCCATCCGCACGTGGGCCGTGGATCATACTGTGTCTTGGGACCACAA
TGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62