GenePrediction:GLEAN_5827 Details

Name: GLEAN_5827
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:719165..718044 (- strand)
Length: 1122
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:719165..718915 (- strand)
Length: 251
Type: CDS
Source: GLEAN
Position: GCSC_173:718836..718044 (- strand)
Length: 793
>GLEAN_5827 class=GenePrediction position=GCSC_173:719165..718044 (- strand)
ATGGATATCGCACTTGAGATCATGGACACGTACGGGTTCGACTATGTCTACTCTACGCTGCTTCCCGCGCCGTCTGCTCC
GTACAACCTAGCGAGCAGTGATTTTGGCGGCAATGCCACCGCTCTCTCGTCCTGGACCTACAAGCCGACGTCTTTCCTAT
TCACACTGGAGCCGAGCAAGTATGCCTACATGAGCGCCTGGAACCGCGACAACATGCTTCGGCAGTACATTTCTCTGTTC
TTGATAACCTGGTGAGTCTTGTCTGTACTGGTCGCGTTTCCTACTTCCTCCGACCAGTGCCTGTCGGCTAATCAATATTA
TTCACGCAGGATCTTTGGACTATTTACTTACTTCCTCTTCTCGACTCTCTCTTACGTTGTCATCTTCGATAAGAAAACGG
CCGAACACCCTAAGTACCTGAAGAACCAGGTGTGGCTGGAGATCAAGCAGGCCAGCACGGCTATGCCCGTCATGGCGCTG
CTCACTGCGCCTTTTTTCCTCGCCGAGGTCCGCGGCTACGGCAAGCTGTATGAACATACCTCTGACGGCCCTGGCCGGTG
GTACGACATTGCGCAGATGCCCTTCTTCCTCTTCTTCACCGACATGTTCGTCTACATGATTCACCGCGGGCTCCACCATC
CCGCTATCTACAAGAACCTGCACAAGCCGCACCACAAGTGGATCATGCCCACACCCTTTGCCTCGTACGCTTTCCACCCC
GTCGACGGCTGGATGCAGAGCCTGCCCTACCACATCTACCCCATGATCCTGCCGCTGCAGAAGTGGGCGTACCTGGCTCT
GTTCATCATCATCAACTTTTGGACTATCATGATCCACGACGGCGAGTTCGTCTCGGACAACCCAATTATCAACGGTGCAG
CCTGCCACAGTGTTCATCACTATGCGTTCAACTACAACTACGGGCAGTACTTTACCCTGTGGGACCGCATCGGCGGCAGC
TACCGTTGCCCCGATAAAGCCGTCTTTGACAAGAAGGCCAAGATGAGCAAGGAGACGTGGAAGCAGCAGGTCGACGTCAT
GGAGGATATCATCAAGGAGGTTGAGGGCGAAGACGACCGCATTTACGACCCGGTCGTCGTGGAGTCCAAAAAGAGCCGGT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62