GenePrediction:GLEAN_5828 Details

Name: GLEAN_5828
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:716193..715321 (- strand)
Length: 873
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:716193..716148 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_173:716082..715988 (- strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_173:715925..715902 (- strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_173:715697..715576 (- strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_173:715492..715321 (- strand)
Length: 172
>GLEAN_5828 class=GenePrediction position=GCSC_173:716193..715321 (- strand)
ATGTCTTTCCCCAACGTTTCGGCCGACCTGGTCTGGGAGATTGTCCGTATGTGCTTGCTGAGGGTCGAGTTTCCGTTCAA
ATCTATATTCTAAACCTCATTGTCTGTCCAGGTCCCCAGAACGCTTTCCTCGTCAAGCGGATCACTGGCGGCGGTGCCCA
CTTCTCCCGGGACCCCCTCAACCTCACGAACGAGCACAGCCGGAAGGTATGTTCAGGAACGGCTTATTTTGCGAGAGGGA
ACAGAGTCTAACGAATGGTGCCTTGCAGTATGCCGGTTTCGTGAACGACAAGGTACGATAACTCTGATTTTCTGATGAAG
GGGGGCGAAAGCTATGAATTTTCGAAACAGACCAGCCTTTTTATATACAGGCTGGCACGAAGCGATGTGTTTGGGGTGAA
TGCTTGGAAACTCGACGAAAGACATGCCGCATCGCAAAAGACAGACACCGATCAGATCACGCACACTGTGTTCGAAGACT
AACATGAGGAATCCAGGCTGTTGGTGTTATTGCCGGTGCTGAGGGTGGCGTCCAGGTCATCACAAAGACCAAGGCCCAGA
ACAAGCCGGCCAAGTCGCAGGTCGTCTCCGTCCAGGGTGCCAACAAGTCGGCAAGAAAGTAAGTGCAGACAATGCCAGCT
CTGCAGGACAATTAGAAGAGGAAAGAAACAACGGATCGAGGGATCTAACATGGCCGAACAGGACCTATCGGTCGATTGCC
GGCGCCGTTGCCAAGTCGGGCTACCGTGCCGACCTGCGTGCCGCTGCCATTGCCCGTGCCAGCGCCATTCTCCGGGCACA
GCGCCCAGTGAAGGCCGACTACGAGGTCAAGCTGCGGGGTACCAAGGCGCGGAAGGCTGCCGAGTCTTCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62