GenePrediction:GLEAN_5829 Details

Name: GLEAN_5829
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:714211..712770 (- strand)
Length: 1442
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:714211..714199 (- strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_173:714090..714059 (- strand)
Length: 32
Type: CDS
Source: GLEAN
Position: GCSC_173:713984..713874 (- strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_173:713799..713712 (- strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_173:713635..713173 (- strand)
Length: 463
Type: CDS
Source: GLEAN
Position: GCSC_173:713117..712973 (- strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_173:712910..712770 (- strand)
Length: 141
>GLEAN_5829 class=GenePrediction position=GCSC_173:714211..712770 (- strand)
ATGGTCAAGGCCGGTACGTGCAAAGCATGACGATGATGCTGTCCCAGGCGGTGCCGTCGAGTTCAATTGGATCTATCTTT
GATCAGCGGAGATTTTGACAGAAAGCTGACCTCTTGCGCAGTCGTTGCTGGTGCCGCTGGTGGCATTGGACAGGTTCGTA
TCAGGCTGGCATCGCTCAAAGCCCGAAAGTTACGACTAGATACTGACGGGAATTTCCTCTGCTACAGCCGCTATCGCTGC
TCTTGAAGCTGTGTCCGCTTGTTGACGAGCTCGCTCTCTACGATGTTGTCAACACGCCAGGTGTTGCTGCCGATCTGTCG
CACATTTCGTCCAACGCGGTAAGCTCTTCCTCGGTCCATGTCTGGTGTTGAGATTGTTTCCGACTTGCTAATGCGGTATT
GTGACAATACAGAAAGTGACGGGCTACCTTCCCGCCAACGACGGTGTCCGTGCCGCCTTCAAGGATGCTGACATCATTGT
CATCCCGGCCGGCATTCCCCGTAAGAAGCATCGCCCGCCCTGACCCTCCTGGACCTGAGAGGTGCTGTTTGGCTGCTAAC
GACATTTTCAATATAGGCAAGCCGGGCATGTCCCGTGATGACCTGTTCAACATCAATGCTGGCATCGTCAAGGGCCTCAT
TGAGGTCGCCGCCGATGTTGCGCCGAAGGCGTTTATCCTCGTTATCTCCAACCCCGTCAATTCGACCGTGGTCATCTCTG
CCGAGGTGCTCAAGGCCAAGGGCGTCTTCAACCCCCAGCGTCTCTTCGGTGTCACTACACTCGACATTGTCCGCGCTGAG
ACCTTTGTTGCCGAGATTGCCGGAAAGTCCAACCCCCAGGAGCTGACGGTGCCTGTCGTCGGCGGCCACTCTGGCGAGAC
CATTGTGCCACTTTTCAGCCAGGTTCAGCCTGCTGTCACGATCCCGGATGACAAGTACGATGCTCTTGTCAACCGTGTCC
AGTTCGGTGGCGACGAGGTTGTCAAGGCCAAGGATGGTGCTGGCTCTGCCACCCTCAGCATGGCCTACGCCGGTTACCGG
TACGTCGAACCGCAGACAGCATTGTGAGCCGCACCGCTTACTGACGTGATACAGCTTTGCCGAGAAGGTCCTCAAGGCCC
AGAAGGGTGCTAAGGGCCTCGTCGAGCCTTCCTACGTGTACCTTCCCGGCATCCCGGGCGGTGCCGAGATCGCAAAGAAG
ACCGGCACCGACTTCTTCTCCGTTCCCATCGAGCTTGGGGTATGAGTCCTCGAAATTACATGATCTCGTAGCGCTGATCG
CTTTGCTGACCCTGCTTCTAGCCCAACGGTGCCGAGAAGGCTATTGACCCCCTTGCCAGCATTACTGAGAAGGAGAAGAA
GCTGCTGGAGACGGCAATTATCGGTCTCAAGGACAACATCGGAAAGGGTGTCAAGTTTGTCCAGACGCCCGCGCAAAAGT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62