GenePrediction:GLEAN_582 Details

Name: GLEAN_582
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:733108..733809 (+ strand)
Length: 702
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:733108..733246 (+ strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_97:733330..733398 (+ strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_97:733469..733809 (+ strand)
Length: 341
>GLEAN_582 class=GenePrediction position=GCSC_97:733108..733809 (+ strand)
ATGGAGAACCTTTCGATTTCTGACCCCCAGCAGCCTCGGGGGGCCGGGGGCCCAGCGGTCCCACAGCCTCCCCTCCAGCA
AGACCAATTGCCGGCGCAGATGTTCACGACGGCGGCGCAGCTCTTGGACCTCACGGACAGTGAGTTTCCTGACACGGGGC
GCGTGATAGGAGACGGTCTTCAGGGCCTGGATGGCGGTGACTGATTGTTTCTCGCTCCGCAGAAAAGCTCATGGTCGTCC
TTCGTGACGGCAGAAAAGTGATTGGTGTCTTGAGAACCTGGGATCAGTTTGGTATGGCATCGAAGTGCCCGTTCCTGCCT
GTTGCGCAACTGCTGACCGACATGGGTCGCACGCCAAACAGCCAACCTAATACTACAGAACGCTATCGAGAGAACGTTTC
TTGCGCCGGGCACGTTTGAGGCAGCAGCTGCGCCGGAGAGCGCGGCCCAAGGCCACGGCCTGTACGCGGACATCCCAAGG
GGAACGTATCTGGTGCGGGGCGAGAATGTGCTACTCCTGGGGGAGATCGACCTAGACCGGGACGACGAGGCGCCACCGGG
CCATGACAAGATCGACTCGGATGTCATGGCAGAGCTCCACAAGAAGAAGAAGGCAGTCGACAAGGCAGCCGAGAAGTCGA
GGGTAAAGAAACTCTCCGTTTTGGGCTTTGAGGGTGAGAACATGGGTGAGATTCTGTTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62