GenePrediction:GLEAN_5830 Details

Name: GLEAN_5830
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:706829..703261 (- strand)
Length: 3569
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:706829..706426 (- strand)
Length: 404
Type: CDS
Source: GLEAN
Position: GCSC_173:706092..705790 (- strand)
Length: 303
Type: CDS
Source: GLEAN
Position: GCSC_173:705621..704429 (- strand)
Length: 1193
Type: CDS
Source: GLEAN
Position: GCSC_173:704336..703261 (- strand)
Length: 1076
>GLEAN_5830 class=GenePrediction position=GCSC_173:706829..703261 (- strand)
ATGGCCAAGAGTGCACGTGCGAGCTCGCGCAAGTTGAACAACCAGAAGCTCAAGAAGAATGTGTTTGGGCCCGTCGAAGC
AGCCCGGACGGAACGGCTGTCGGCCAAGCTGATGGAGCTGGTGGCCCAGCAGCTGCCGGTCGCCAAGGAGGTCGAGGGGG
CCAAGGAGGCAGGCGCCGTGGAGGCTGTGGCTGATTCGACGCCGAGCGCCCAGCTGCGCGACGAGAACACCGAAGGTATG
GATATGAACGGACCGCTGCAGCGATCGGCTTCGTGCCTGGCTAACGAGGCTGCAGCCATGGACGTCGACTCGGCCGCCGC
CCGCGGAACCGGTGCGGGGACGAAGCGCATCGTCAAGCGCAAGGTCAAGAAGGGCTCAATCGTCTTCCGCCGATACAAGG
ACCGGTCCTCGAGCAGGCGGAAGTGAATGTGGGCCTGGCAGGGGGCGGAGGATGCGGGCACCGGCACAGCCGAGACCTCG
TCTCTGACGACCTCTGAAAACCTATTCAGTAGAGATAGCCTACAATGCAACGACGTTACGACCTTGGGCATGTTTTCGAG
TTTTTATTTTATTTTATTTTTTCTGTAAGGCTGTTCCCCGTAGGCGGTGCTGTCAGCTGCTGTATTACAGGGCTATTAGC
GCCGGACGCAACGCGCTCCAATGACAGAAGGCGCTGTGGGGCCGAGCCTGGAAAGCTCAACTGTGGCCGTACCAACAAGA
CAGTAAGCAACGGCCAGGTCGCATCGCACCATCTGCTTCTTGGCATCCATTCCTTTGGCAGCAGCATCTGCACGCCGCGC
TCTCCTCTACTGCCACGATGGTCGCGCAGCCGGCCGCACGCACGCCTCCCTTGGCGGTCCTGCTTCTGGTCGTGGCCAAT
GCTCTTATCCCGCTCTCGCTGGCCGTTCTTTTGGCCAGGGCTTCTTCCCGTACAAGCCGCTGCTGCCGGGCCTGGCTGAG
TATGCCGACCTGGGCTATGGCCCGCCGGCGCCGGCGCCGTTTGACCGTGTCATCTTCATGGTGGTCGACGCCCTGCGGAG
GTGAGCGCGATGGACGATGGACGATGGTATGGTGACGACGTGGGCTTGTTTGCTGACGGACCAGTGATTTTGTCTATGCG
CCGAACAGCGGGTTTGCCTATACGCAGTCGTGAGCAGCTTCTCGTGTCCTTCCCTCCGGCCAAGCTGACCGTCTAGACTC
ATCCGCAGCGGCGAGGCCGTCCCGTTCACGGCCCTTGCCAGCTCGCCGACGGTGACGATGCCGCGGCTCAAGGCGCTCAC
GACCGGCTCCACGCCGTCGTTCCTGGACGTGGTGCTCAACGTGGACGAGGGCGACCGGTCGTCGTCGCTGGCGTCGCAAG
ACACATGGTTGGCACAGATGCGGGCGCGTCAGCCGGACCAGAAGCTGCTGCTCTATGGCGACGACACCTGGCTCAAGCTC
TTCCCCGACACCTTTGACCGGGCTGACGGGACGACGAGCTTCTTCGTGTCCGATTTCACCGACGTCGACCGTAACGTCAC
GCGTCACGTTGCCGGCGAGCTGGCTGCGGCCGACTGGAGCGTACTCGTGCTGCACTATCTCGGCCTCGACCACATCGGCC
ACAAGGGTGGTCCGCACAGCCCGCACATGACTGCCAAGCAGCGTGAGATGGACGACGTCGTGCGCCTCGTCTGTGACGCC
CTCGCCTCTGAGCCGCACCTGGCCAAGACCCTTCTCGTGCTCGCCGGTGATCACGGGATGAACGAGGCCGGAAACCATGG
CGCCTCGTCAGCCGGCGAGACGTCCCCGGCCCTGCTCTTTGTGGCCCCTCGGCTGCGCGTCCTGGCTGGTGACAACGACG
GCCGCCCTGCTCGCACGAGTCCTCTGGCCGACCGTGACGACTTCCACTTCTACCAGACCGTCGACCAGGCTGATCTGGCC
CCGACCCTGGCTGCCCTGCTGGGCTTTCCTGCTCCCCGGAACAGCCTCGGCACGCTCATCCCGGACTTTTTGCCGCTGTG
GCCGCAGCGTCGCGACCGCGCCCATCTTCTGCTGCAGAACGCCCACCAGATGCTGGCCGTGCTGACGGCCGCCTTTGGGC
CGACGCCCTTTGAGCGCCGCGACGACGCCACAGATTTCCGCGACTGTGCCGATCCGCGATCGGATGACATCACCAGACTC
GGCTGCTCGTGGCAGGATATCGTGCGCCATTCTCCCGGTCCCGAGGGCGATCTGGACGGCGAGTGGACGGCGCAGACGAT
CGGCTGGCTCCGGCTGGCTCAGTCCACCATGAGCGGCATGGCTAGCGACTATGACCTGGTCAAGCTGGGGCTTGGGCTCG
CGGCTGCAACGGCCAGCGTCGTCTTGGCCGTCGGATCGTCGGTCCTGCTCGGGTCTGGTCGTGGTGGCATCGCGGCCGTC
GGTCCGCTTGTGGCTGTCGGGGTCGCCTACGGAGTGATGATGTTTGCCAGCAGCTATGGGTCGAGGAGGAGCATCACTTC
TGGTACTGGACAGTGACGGCATGGGTGGCGACCGTGGGACTGCGCAAGCTGGCTGCCAATCAGAAAGATGTGCTGCCGCC
TGTCGTGGCCGTGGTGGGAGCCCTGACGGCATTTCGGCTGGTGCGGGCTTGGAACCAGACGGGCCAGAAGTTTGCCGGCG
CGCCAGACGTGGCCAAGACGTTTTTGCAGCCGCAGCCGCAGCTGTTGTGGGCTCTTGTCGGCGCTACATATGTGCTGATC
GGCTGGCGGCTGGCTGGTAGTCTGTGTTCGTCGCGATCGCAGGCCGTGGTGGTCATGCCGGCTGTCGTCCTGCTGGTGGC
CCTGGCCTTTTCATTCAAGCTGGCCTTTGCGCTCGAGGACTCGCCCGAGCTCGTCGGCGACGCCGTCCGGCCGCTGGCCG
ACCTGTTTCGCAGCACCAGCACGGTCGTCAATGCTTCTCTGGTGACGCGTGCACGCATCGTCTTTGTCGGCTTATCCATA
GCCACGTCCGTGGTCGTTGTTGCTGGCCGTCAGGCTGCCATTGCTGCCGGCCTTCTGCACGTCTACTCGCTGCTGGCCGT
CACGCAGTCGCGGCCCGTCAACGTGCCGCTCTTTCTGCTATTTGACGTCGTCTTTCGCTTTCTGGCTCGCCAGCAGGCTG
AACTCGCACCGGCTGAGCTCACCACGGCCTCGCTGCTGCTGCAGACTGCCTCCTTCTTCGCCCTCGGCGGCACCAACGCC
ATCTCCAGCGTTGACCTGTCGTCTGCCTACAACGGCATCACTACCTTTTCCGCTCCGGCTGTCGGCCTGCTCATCTTTGT
CAGCAATTGGGCCGCCCCCATCTATTGGGCTCTGGCTGCCGTCGTCCTGCTTCTGCAGCAACAAAAACAGAGCCCTGCCC
TGCTCTGGATCCGCCACGTCGCCCTGCTGACCGTCTTTGCCGCCGGCAGCACGGCTGCTGTCATGGCCGCCTGCGCTGCC
ATGCGCACACACTTGTTCGTCTGGACCGTCTTCTCGCCAAAGTTCCTCTACTGCACGGCCTGGAGCCTGGGCATGCACTT
GGGCGTCAACGTCGCTCTCGGCGGGCTGCTGTACGGACTGGGGAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62