GenePrediction:GLEAN_5832 Details

Name: GLEAN_5832
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:696657..695613 (- strand)
Length: 1045
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:696657..696452 (- strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_173:696296..696091 (- strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_173:696038..695804 (- strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_173:695754..695613 (- strand)
Length: 142
>GLEAN_5832 class=GenePrediction position=GCSC_173:696657..695613 (- strand)
ATGCTCCCACGACACCTGGACATCCACCCTCGCCAGACCTTGACACCCACCCTGCCTTCATCCTTCGTTCAGCTCCGATC
GGGTCGCACCGGCTGCTCTCGTGCTCCCGTCCTGCTGCCATCGGCCAGCTGCGAGATGACCACACGACCTGGTTGCGTCT
GCTGCCTGTCTCAGCTCGACCTGATCGTCTTTTCCGTCTTTTCTGTGTGAGAACAGACGACTGAAAGGAATTTAGCCCTG
TCGTTTGCTCTCAAGCGCACGATGCCCCTTGCCCTCTCGTCAAGTCACTGGTCCACAAGCAAGCTGCTTTCGAACACACA
CGTCAGATCTGCCACCACCTGACCATGACATTTCTGCTCAGATCGTTCGCCGTCGCCAGCGGCCTACTTATGGCCATCGT
CGCCAACTGTCACGACGCCACCCAGAACGCCCGGCCGGGTGCCGCCCACATCCAGCTGTCGCCCACTCAACGTGCTCAGT
TCAGCTTCCAGCCCTTTGAGCTGACAGACGTCTGCTTCGCGTGCACTCGGCCCAACGCAACCGTCCTGTTTGCCTGCAAC
GTCCAGTGTGGGTGATCCGTCCCGGAATTGGCTGTCTTGCTCTGCTAACATCCTGTCAGTCGACTGGTTCGACCCCAACT
CTGTCAAGGAGAACAATGTCACCTCCTGCTCCTGCTCCTACTCATGGCATTGGGACGGACAGGCAGCCGCAAACGGCGCC
AACAACACCTACGACGCCGTGGACTTTCTCGTCTGCTCCAATCACCACTCGTCCCTGTTTGAGATGCGCGTCAATTTCTT
CTCAGACCCAACCAACCTGACCCTCTTCATGAGCCACTACTACAAGGATAGCTCGTGAGTGCACCCGTTTCATCGTTCTG
CTCCGCTCGAGCTAACAGCACAGCCTCTGGGGTGCGCCCTATCTGTATGTCCAGACCTGGGCCATGCCCATCCTCAATCT
AACGCGCGAGAGCCGCGATAACGAATCAATGCGCTACTTCAAGGCGGGGCCAATCCTTGCCAACATCACTGGCCTGGACG
GCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62