GenePrediction:GLEAN_5833 Details

Name: GLEAN_5833
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:694147..693197 (- strand)
Length: 951
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:694147..693542 (- strand)
Length: 606
Type: CDS
Source: GLEAN
Position: GCSC_173:693463..693197 (- strand)
Length: 267
>GLEAN_5833 class=GenePrediction position=GCSC_173:694147..693197 (- strand)
ATGGCATCGTCTCAGTCACCCAAGGCGACGCCTACACGGCCCGCCACGTCGCGCCTGCTGGCCATGAAATTCATGAACCG
GCTCGGAGGATCTGCCGACTCCCCGCCTACGCCGTCGTCTCCGTTGGCCTCTTCGGAGCCCTCTACGCCGCTGGCCAAAT
TCGCATCGGCCGGTGCGCTCAAGGATGCGATCGGTGTGGACGGCCGGGGCGATGAGAGCGGTCGACGCTCGGCAAAGAGG
CGCCGGGTGTCTGGCGTCTCCGATGCCGCCGGAAAAGACGAGCCCGAGGATGGTGCTGCAGCTACGATGGCTACCATGGA
AGCCCAAATGAAGGCTTCCATGGACGAAGAGGAGCGGCGACGCCAGGCGGCGATCAAGAAGCGGGCAGCTGAGCTGGGCG
ACGAGCAGTGGACCTGGGACAGGCCGCTGCCACCGCACATTGCCGCCCGGATGGCAGCTGCCGGCACGGCCGCCTCCAAG
TCCAGGACGATGGCCTACTCGTCCGTCGTGCGGGTCGGGTTCGCAGAGATCGACAGCGCCGATCACAGCAGCGATGCCGA
CCCGATCAAGCCGACAATCATGCGATTCAACATGAAGAAATCAAAGGTACGCTGAAGCTTTGCCGAAAGAGGAGCTGGCT
CTTTGCTGCTTTTGTTCCTTGTGCTCACACTCTGTCTGGCATAGGCCGCTGGCGAATCCACGGGGGACAGCGATGAAGAC
GGGGAAGACGAGGGCGAGCTGGCCAATATCGGTGGATCCCGAAAGCGGTCCCGGTCAGATGCAGGAGGACAGCGGAAGAA
AGGCCCGCCCATGAAGCTGAAGCATTTGACGTCCTTGTCGTCCCAAGGCGGCCAGAACACGATGAAATGCCATCGATGTG
GTCGCGCTGGCCACAAGTCTGCCAGCTGCCCGTCGACCAACCTGAAGAGGTCAGGCTCGAAGAAGCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62