GenePrediction:GLEAN_5834 Details

Name: GLEAN_5834
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:688892..685429 (- strand)
Length: 3464
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:688892..688650 (- strand)
Length: 243
Type: CDS
Source: GLEAN
Position: GCSC_173:688569..687715 (- strand)
Length: 855
Type: CDS
Source: GLEAN
Position: GCSC_173:687656..686021 (- strand)
Length: 1636
Type: CDS
Source: GLEAN
Position: GCSC_173:685946..685429 (- strand)
Length: 518
>GLEAN_5834 class=GenePrediction position=GCSC_173:688892..685429 (- strand)
ATGTCTTCCAGTGCAGCGACAGAGGGGGACCCCCAGCTTCGGAGAGTGACCATCGTCACGGAAGCTTTAGAGAAGCCCTC
TCTAGACGACCGGTCCTATCGGGTCATCAAACTCGGCAACCAGCTAGAAGCTCTGCTTGTACAGGACTCCAAAACTGACA
AGGCCAGCGCCTCGCTCGATGTCGGCGTCGGAAACTTTAGTGACGCCGCCGATATACCAGGTCTGGCCCATGCAGTCGAG
CATGTAAGTGTCAAAAAGGCTGCCTCCGAACGGCCACGGGAAGGGCACAAGAGGAGGGATGGCGAGCTGACGTGCTTAAA
TAGCTGCTGTTTATGGGCACCAAGAAATATCCAGAGGAGAACGAGTACAACCAGTATCTCTCATCGAACTCTGGAGGCTC
CAACGCCTATACATCGTCGACGTCGACCAACTACTACTTCGATGTGTCTAGTCAGCCGCACAACGGCAAGGAGGCATCAG
CCGAGAACCCGTCGCCTTTGTACGGTGCTCTGGACCGATTCGCCCAGTTTTTTATCCAGCCTTTGTTCCTGCCCTCCACC
GTGGATCGTGAACTTCGTGCCGTGGATTCGGAGAACAAGAAGAACCTCCAGAACGACCAGTGGCGCATACATCAGCTGGA
GAAGTCGCTGTCGGACCCCAGACACCCATTTTGCCACTTTAGCACGGGCAACTTGGAAGTCCTAAAGATTCAGCCTGAAG
CGCGGGGAATCAACGTCCGCGATAAGTTTATCGAGTTTCATGACAAGCACTACTCGGCAAATCGGATGAAGCTCGTCGTT
CTGGGCCGTGAATCGCTGGACGTCTTGCAAGATTGGGTTGCTGAACTCTTTTCAGGTATTCCGGACAAGAATCTGCCGCC
GAACAAGTGGACAGACGCCGAGCCCTACGGCCCAGAATATCTTGGCCTGCAGACTTTCGCAAAGCCGGTGATGGATTCGC
GAGAGCTTAACCTCCGTTTTCCATTTCCGGACGAGTTTCTGCTCCACGAGTCTCAGCCAAGCCGGTACATCGGCCACCTC
ATTGGCCACGAGGGCCCGGGAAGCATTATGTCTTATATCAAGTCAAAGGGTTGGGCGAACAGCTTAGGAGCCGGGATGTA
TCCGGTCTGCGCGGCAACGCCCAGCGTTTTTGACGTGACCATACGATTAACCGAAGAGGTGTGCAACTGTCTTGATTTCT
CTATGTAGCCCCGTCCATACTGACCAGCTTGAACAGGGCTTGAAAAATTACAGGGAAGTTGTTAAGGTCGTCTTCCAGTA
CATCTCTCTTCTCTGCGAATTCACGCCTCTGAAGTGGATTTACGACGAACAGAAGGGCATGGCGGACGTCGATTTCCGAT
TTATGCAGAAGGCACCTGCTAGCCGCTTTACAAGCAAGACAAGCTCACTCATGCAGCGGCCGCTACCTCGCGAGAGGCTT
CTCAGTGGAATGAGCTGCATCCGGAAGTTCGAACCCGAACTCATCAAGCAGACGATTGGTTATCTGCGGCCTGACAACTT
CCGGATGACCGTGACATCCCGCACGTTCCCAGGAAATTGGGACCAAAAAGAAAAGTGGTACGGCACCGAGTACCGGGTTG
AGAAGATCCCAGAAGACTTCATGGGGGAAATCCGCCAGGCATTCTCTGTGCCAAAGAAGGACCGCATCGCCAAGCTCCAT
CTGCCGCACCACAATCAGTTTGTGCCGACCAAGCTTGAGGTGGAGAAGAAGGAGGTCAAGGAGCCGGCTCCAGCGCCGCG
CGTTATCCGCAACGATGAGGTGGCCCGGACCTGGTGGAAGAAGGACGATACCTTTTGGGTGCCCAAGGGCACGCTGTCGG
TGAACCTTCGGAGCCCGATCATCTTTGCTGGGGCTGAGAATGTGGTCAAGACCGAGCTGTTCACCGAACTGGTACGGGAT
GCTCTGGAAGAGTATGCGTATGATGCAGATCTTGCCGGCTTGATGTACAGCGTCGCACTTGAGTCTCGGGCTCTCGTGGT
GGAGGTATCGGGATACAACGACAAGCTGCCGGTGCTCTTGGAGCAGGTGCTGATCACGATGCGCGACCTCGACATCAAGG
ACGACCGGTTTGAGATTGTGAAGGAGCGCAGCAGCCGCAGCCTGCGCAATTACGGCTTCCAGCAGCCGTACTACATTGTG
CCGGACTATGTGGCCTGGCTCACGTCGGCATCGTCCTACACGGTGGAGGAGATGGCATACGAGCTGCCGGCTATCACGGC
CGAGTCCATGCGGCGGTTCGTCAAGGACCTACTCGGCCAGCTGCACCTCGAGACCCACGTCCACGGCAACATCTACAAAG
AGGACGCACTGAAGCTGACAGACGCCATTGAGTCGACACTCCGCCCACGCCCCCTGCCAAAGGCGCAGTGGCCTGTCTGG
CGCGATGTTGTGCTGCCGCCAGGCTCCAACTATGTCTTCAAGAAGAAGTTGGAGGATAAGGAAAACGTCAACCATGCGAT
CGAATATCTCCTGCACATTGGCAGCCGATCAGACCGTAGAGCCCGGGCGCTCACGCTTCTGCTCGACCAGCTCACGCACG
AGCCGGCATACGACCAGCTCCGCACCAAGCAGCAGCTCGGCTATGTCGTCTTCAGCGGTGCCCGGTCGGGCACCACGGCC
CTAGGTTTCCGCTTTCTGGTGCAGAGCGAGAAGGTGCCCGCATTTCTTGAGGGCCGCGTGGACGCTTTCCTGACCGAGTT
TGCCGACACGCTGGCAGAAATGAGCGACTCGGCCTTTGAAGGCCACAAGCGCAGCCTGATAGTTAAGCGGCTCGAGAAGC
CCAAGAACCTCAATCAGGAGACGGCGCGCCACTGGGTCCAGATCTGCAACGAGTACTACGACTTTGAGTTTGGTAAGTAT
AGGCCCGGCAAGAGGGTCCAAGGGATCAAGGGATACGCAGGCTAACCGATTTTCTTTCTCTTCCAGCCCAAAAGGATGCA
GCGGAGATCAAACTGCTGACTAAGGCCGACATGGTGGAGTTCTACAAGCAATACATCCACCCAGAGTCGCCTCACCGTGC
CAAGCTCTCCGTGCACCTTGTAGCGCAGGCTGAGAGCGATGTTACGACGAAGCAGATCAGCGAGCTGGTGAACACGCTCG
ACCTGGATGATAGCACGGCCAAGCAGGCGGAAGCGGATCTACAAACACGACTCAACACGGCGCAGCAAAGAGACGAGACA
GACGAGATTGAGGATCTCCGAAAGTACTTGGCCCAGAGCCTGAAGGTGACGGACGACAAGATTGACGCGGCCTTGGAGGC
GTGGAAACCGGTGTCCGACTACCACAAGGTGGCCAGCGAGAAGGAGGGAGCAGAACTCGCACCAAACGGCACGACGCCGG
TACGGATCGAAAGCATTCGTGACTTCCGGGCGAGTCTTACGTTGATGGCCAGGGCGATGACGACAGACATTAGCGAGTTT
TCGGACGTCGTGACGAAGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62