GenePrediction:GLEAN_5835 Details

Name: GLEAN_5835
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:683552..678006 (- strand)
Length: 5547
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:683552..683404 (- strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_173:683126..679024 (- strand)
Length: 4103
Type: CDS
Source: GLEAN
Position: GCSC_173:678850..678006 (- strand)
Length: 845
>GLEAN_5835 class=GenePrediction position=GCSC_173:683552..678006 (- strand)
ATGCTGGAGAGAGATCCGTGCTCCGTGACCGCCTTCTTTGACGACACCTTGCCACCGCCAGCAGCCGTCGACCGCCGCTC
CGCCCAAACGGTCTGCCTTTCCAGAGCTGCCCGGGCAGCTCACTTTCACCACGTCTTCCCTAAAGAAACGTAAGATCTCC
CGTCCGTCGAGAAGAGGCGACGACAGCGTTCTCGCCCAATCGACCCATCATCAGAGACAGCCACAGCCACAGCCTCAGCC
CCAGGCTCCCACGTCAAACGGCTCCCACCTGATCCTACCGACAACTGAAGGCGAGGAGGTGGAGGACATTGACTTTCTCG
GAAACGACGGGGACGAAGACGTCGACGACGACGAAGACGACACAGACGACGAAGACGAAGACGAAGACGAAGACGAAGAC
GCCAACAACAGCGACTTCCAACCCAGCTTCTCCTTCTCGGCCGCGTCGACAATTGCGTCCTCCACACGAGCCACGCCATC
CTACTGCGGCCGCGACAGTTCTGTGCCTCTGTCGGCCACAGACGAGCCTGCCGACATCAGCAACGCCGGCGATACTTCTT
CGCCGTCGCTGCAGCAGCTGCCGCTCCCGGCACATCGTCATCCCCATCGACGGCTCGCACGCAGCCAGTCGCCACTTGTC
ACCGTCTCGCACCGTGCGATTGTCATGGGCGGAACTGCCGACCTGCCGCCCAGCTACAGATCGAGTTCGCCTCTGAAGCG
GCCTGCCTCCAGCATGGACAACAGCACGGACGGTGGTGCTGCTCCGACCAACGTTGACATGGCCATCTTGCCGGCCGATC
AGCCAGCAGAGGCACTGAAGCCGGCTCCTCCCATCGAGGAGCAGATACGGACGATCGAGGGCCTGGTCAAGGACTTTGGC
AGCAGCGAGCTGCAAGAGGGCACGACCGCCTATCTCGTCTCCCGGCGCTGGCTGGCTCAGGCGCAGGCTCTCGGCAGCGG
CGACGCAGCCAAGGCGGCCAAGGCGGTGCCTCTGGGCCGACTCGGGCCGGTCGACAACGCAGACATCATCGAGGGCGTGG
TCCAGGACGTGGAAGGCAACGACGCCGTGCGACTCAAGCCGGGCACCGGCCTCGAGGACTTTGAGCTGTTTTCTCAGAGC
GCCTGGGACCTGCTGGTGTCGTGGTACGGGTTGGCGGACGGCCAGCTACCCATCGTTCGCGTGGCACACAACACGGCGCC
GACGTCGACGATCCCCAACGTGCAGTACGAGCTGCACCCTCCCGTCTTCACGTTGCACCGCCTTTGGTCGCTCACCAGCG
GCATTCCCTTTGACAAGGAAGTCGGCGACGTCGAGCAGCCGCCGCCTTACATCATGTGCTCCAGCGCCTACAACATGCAG
GCCTTCCTCAAACGGGCCAAATTCCTGCTGCACATCCCCGTGAGCCGTCGTGTGCGCCTGTGGCGAGTACCGCGAAAGCT
GCCAGCTGGTGAGCCAGCAGCAGCAGCAGCAGTCCGGCCCGCCCCAGTATCACAAGTATTGTCCACGCCGCCGGACTCCC
CCCGTCTTGACGCCACGGGCCTGACCAACCCCCAGGACTCGTGGTCCCGGCTCCTGCTCGAGGTGGCGGACTTTATGAAG
CTCGAGGTCAACTCAGAGCGCGAGACCCTGGCGATCAAGGACTTGACGCATGACCGGAACTACAACGGCAGCCAGCCGCT
GGCGTTTGCGTCACTGACGGTTGACCAGACGCTGGTGCTGGACGAGAACATCGAGCGCACCATGTGGGTGTCCACGTATC
ACCCCAAGGGCAACAAGGACAAGGCAGGCGCAGCGACGTCCTCGTCACGACCCAACAGCAGCCGCGCCAACCATGCATCT
GCGTCCGCGTCCGCGTCTGCGTCTGCGGCAACAGCGCGGACCGGGATCGCGGCCAGCGCGGCCAGCAGCGGGCGGAACAG
CCCAAACCAGCAGGGCGCCTTCACGCGCGGACGGGCTAAGCAGAAGTCGGGGCGGGTGATGGGTTGCGTGGGGCTGAGCA
ATCTGGGCAATACGTGCTACATGAACTCGGCGCTGCAGTGTGTGCGCAGTGTGGAAGAGCTGACTAAGTACTTTCTCGTG
CACGAGAGCGACGTGGAGATCAACCAGGTCAATCCGCTGGGCCACGGCGGCAACGTGGCGAAGGCGTACTCGTACCTGCT
GGACGAGATTTACAAAGACAATGCGCCGTCGTCGATCTCGCCGCGCGGCTTCAAGTCGACGATCGGGCGGTATGCGCCGG
CGTTTTCAGGCTACGGACAGCAAGACTCGCAGGAGTTTCTCGGTTTCTTGCTGGACGGGCTGCAGGAGGACCTCAGCCGG
GTCAAGAAGAAGCCGTATATTGCCAAGCCGGACTCGACGGACGAGATGATTGGCAACCCGGCAGCGATTAGGGAGATGGC
GGAGCAGGTGTGGGACATCACGAAGAAGCGGGATGACTCGGTGATCGCGGACCTGTTCACGGGCATGTACAAGTCGACGC
TGATCTGCCCGGTGTGCCAAAAGGTCAGCATCACGTTCGACCCGTTTACCAACCTGACGCTGCCGCTGCCGATCCAGAAC
GTGTGGACGAAGCGGGTGCGGTTTGTGCCGCTGAACGACCGGCCGGTCAACCTGGACGTGGAGCTGGACAAGACGAGCGG
TTTCCGGGCGCTCAAGGAGTTTGTGGGGGCGCGGGTGGGCGTGCCGGCAGAGCGGCTAGTCGGGGGGGCCGAAGAGCTGC
GCGGCAACTTTATCAAGGTGTTTGACGACTTTGCGTGCGTGTCGGAGGAAATCAGCAACGGCGACACGATTGTGCTGCAC
GAGGTGGAGGCAGCGCCGACCAACCTGACGGCCAGCAAGACGCCGCGCAAAAAGTTCCGGTCGATGATCCTCGACGACGG
CCAGGAGATCTTGCCGTGGGACAGCCCGCTGGCCAAGCGGCTGTTGGTGCCAGTGACGCACCGGTTCGACCCGCTGCAGT
CGGAGTCGGGTAGCAGCAGCAGCAGCAACCGGCACTTCAGGGGCAGCAATGCAGCCGGCCCGGCGCACTTTATCATGCTG
ACACCGGAAGAAGCCCGCAGCGAAGACGTGATCCGGCGCAAGATCCTCGAGAAGGTGGCGTCCTTCTCGACGTGGCCCGA
GTTCGCCAAGGCGGACGAGGAAGCGTCGGAGGCGGGCAGCAGCAGCAGCAGCAGCGGCCACGTGAACAGCAGCTCCGAAG
GCACCGAGGGCGTCTTCAGCGTCTCGGATGCCGACTCGGCAGTCTCGGGCAAGGTGACGGCGCGGTCAGTTGAGAGCGAA
GACGACCTGGTGGACGTGACAATGAAGGACGGCGAGATGGAACCGCAGTCACCGGCGCAGACACAGGCACAGGCACAAGC
CAAGGCGGTGCTCTACAGCTACAACCGTCGGCGGCCAAAGTGGGTGTCCGATCCGAGCACGTATCTGCCGGGAGAGCTGC
AGAATCTGTTTGACATGAGCTACTTTGACGATGCACACAACACGATCCCGACCCGGTGGATTGGGTCCAACGACGACAAG
CCGTACCCGAGGCTGCGGTCGCGGATGCGAAAGCCAAGCACAACAGCGACAGCGACCGGAACCGAGATGCAGAGCCCGGG
CACGGTGGACAATCTGGGCGGCAGCGACAACGACAACGAGAGCGTTGCCGGGGATGCGCCGACGCCGGAGCCGATCGTGT
CGGAGGTGACGCGGATGGTGGACGAGTCAGAGTCGGAGGACAGTGTGCTTCCGGCCGTGCAGCGGCTGGCATTCCGGCAC
ACGGCAGCGACCAAAGTAGGGGGCCGGCGGAAGGCAAACAAATCGGGCGCGAAGACGCACGTGACCAAGGGCGTGAAGCG
GCGATCACGACAGCTGCAGCAGACAATGGTGTCACAGGGGCAGACGACCGAGACGACGTCGGACGGCGACCAGGCGACGG
GAGCATCACAGGTGTCGCGGCTGTCGGAGGGGCCGGGCAATGAGGAAGCACCGCTGGTGCGGATAGGCGAAGGCATCGTG
GTGGAGTGGAGTGCGAGCGCGTGGGATGCCGTCTACGGCAAGGGCGGCGAGTCGGATGAGCTCCGGGGGGCGCCGACGTA
CAGCGAGCCGGTGATGCTAGAGGATGCGGAGCTGCAGGAGAAGAAGCGGCAGCGACTGTCGCGACGGAAGCACGGGCTGA
CACTGGACGAGTGCCTAGACGAGTTTGAGCGCGAGGAGATCTTGTCGGAAAACGACACGTGGTACTGTCCGCGCTGCAAG
GAGCACCGGCGGGCGAGCAAGAAGTTTGATCTCTGGAAGACGCCAGACGTGCTGGTGGTGCATCTGAAGCGGTTCAGCTC
GAGCGGGTGGCGGCGCGACAAGCTGGACACGCGCGTGGACTTTCCCGTCGTCGGCCTAGACCTGACGAAGCGGGTGCTGG
ACCGCCAGACAGGCAAGCAAGAGACATACGACCTGATCGGTGTGGACGACCACTGGGGCGGTCTTGGGGGGGGACACTAC
ACGGCCTTTGCGCGGAACTTTATCGACGGCCAGTGGTACGAGTACAATGGTGAGTTGTGGTGTGGTGGTGTTGAGATGTG
ATGAGATGTGATGAGATGTGATGAGATGTTTGTGTTGTTTGTTGTTTGTGTTGTTTGTGTTGTTTGTGTGTTGTTTGTTG
TTTATGTGCTGTTTGTTTGACTGTGGATATACCTCTGCACTTCTCGCTAACAGTCGCAACAGACTCCTCCGTGTCCAAGG
TCAGTGATCCCAACCGGGTTGTCTCGGCGTCGGCATACCTGCTGTTCTACCGAAGAAGATCAGACGTGCCCCTGGGAGGC
CCACGATTCCAGCAGATTGCCGACCGGTTCAGCCGCGAGATTGCAGCTACCGACGACGACGACCGCTCGGATGGTGGGTC
GGGGGAAGGTCGGCGTCTCGGCACAGCCTCCTCCTTAATTGGGTTGTCGAGCGCATCGAAAGGAGCCGGAGCCGGAGCGG
CTCTCCGTCATCCGGGCGTCGGTCCTGGTTTGGTTAGTGGCGAAGGCGGCATCGGTGGCGGCAGCAGCAGCAACGGGAGC
ATCAGCAGCCTGAAAGCCGCAGCTGGTGGCGACCATGACTACCTCTACGACCAGCAGAGTGACGGTGACCCGATTGATTT
CTGTGCCCGGCCAGCCGGTTCGACGGGCATCCTGAACTTTGGCAGCAGCAGCCAGCACGTGGAGCAGCGGGACGGCGACA
ACGACAACGATGAAGACGACGACAGCAAGACGGGCGGCAGCCGCGACGTGGCGCTCTGGGACCAGCCGTCGTGGAGCTTC
GGACACCTCGGCAGCGGCCACGGCTATGGCGAAGGCGAAGGCGAAGGCGAAGGCGAAGGCGAGGGCCTGCTGCTGTCGGC
GGCATCGTCACCCCCACCGCCCGATTTGCTCGCACAGGCCGGCATGGAGGACATCCAGAAGCAGATGTGGGCGCGTAAGG
AGTCGCAGGCACAGATGCACACGGTGATGGCAGACATGGATGACGACTCGGGCAAGGCGGTGGAGATTCGCGTGAGCGAG
GACGAGACCGCGACGATGGACGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62