GenePrediction:GLEAN_5836 Details

Name: GLEAN_5836
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:673035..670162 (- strand)
Length: 2874
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:673035..672858 (- strand)
Length: 178
Type: CDS
Source: GLEAN
Position: GCSC_173:672782..671916 (- strand)
Length: 867
Type: CDS
Source: GLEAN
Position: GCSC_173:671832..671240 (- strand)
Length: 593
Type: CDS
Source: GLEAN
Position: GCSC_173:671187..670162 (- strand)
Length: 1026
>GLEAN_5836 class=GenePrediction position=GCSC_173:673035..670162 (- strand)
ATGGATGCTACTCGCTGCAACGTTATCTATGTCGACCGGATCATTCGTCTGGACCGGGTTCACCATTCTGGATCTGGACA
CAACATTCAAGGACAGCTGACAGACCACGTGTCTGTTGCCTGGGAATCACGTATTCTGGAAAACAACGTAAGGAAGCTGG
CAAACGTCTTTGGCGATGGTATGTGCCCCAGTGATACAAAGTGGTCGATTTCTGATAGCCAGGATCGCTAATCCTGCTTT
CTCGCGCCCTTAGTCCACCTTTGTTCCACGGGCAGCGCATGTATATCGAGACTGTTCAATTTGCAAGACGAGTCTATGCT
GGACCTGAAGCCAACCATTGTGCTGATCGATACGCCCTATGACGAGCGAATACCTATGGAGGACCAGACTCGGTCACGAT
CGCCATCCCCTCATTCAGCACCCCAGACCGGTGTCGACGAGGATCCTTTTTCTCCGTCCGCAGACGACGTTTATGGCCTG
CGATTGTTACAGCGCATAGTGTCTGAGGCTCATCTGCGCAATCTAAGCAAACTTGTCGTACCGGTTCCTGTCATTGACTT
TCCCGAGTCCAGGGCCAATACCTCATATGGCTCTGCGGCTCTGAGTCCCGAAATAGACGGCTTTTTGTCAATTGAGCCAC
AACCTCCCCGACCAGACCGACCTGCGAATCGGCCACTTTTGAAGAGGTGTCTCACACTAGGCGCTACCGACGTCCTCCTC
AGCCCCATCCATTCGCAATGCATCACCGGCCTCGAGATCCACGCGTACTGGGCTTACAAAAGCGCCGTACGTGATCAGCA
GGTGCTATCAGAGTTTCGGCGTGGCCGTAAACGCTCCTGGGTCGGCATTTCTGACACGAGGCCGTACGCCTATCTGCGCG
AGAACATGGTTGCAACTCTGATGCGGAGAATCTGCCAGATGGATGATGCTGCCGAATTGCCCGTGGAGACGGTCCGGCTC
TCCGTTGCCGCTCGCCGGAAGACGGTCATATCAAAGGAAATCGGAAACTGGCATTTTTCTGCACACGACCTGAGTGATGA
CGAGTTGGTTGAGGCTTCGGCGTTGATGTTTAAGCATGCGTTGAGCATGCCGGAACTAGCACGATTCCGGATAGCAACAG
GTAAGGCACCTGAACAACAGGCTTTTTCATTCGTTTATACCTGGCCTTGTGCTGCGGCTGACAGCTCGATTGCTCCGCTT
TAGACCAGCTGATTTGCTTCCTCATCGCGTGCCGGGCAGCCTATAATGCTTTTGTTCCATACCACAACTTCCGTCACGTT
GTTGATGTTTTACAGGCAACGTTCAACTTTCTCGTCAAAATCGGTGCTCTTCCCCCATATCCGGTGCCGTCACCGTATGA
GAAGCCTGCAACACCACTGCCGACACCGAAATCGCCAATGGCGTCTCTTATCCGGCCATTCGAGGCGCTGACCTTGCTCA
TCACTGCCATTGGCCACGATGTAGGCCATCCTGGCGTGAACAATGGCTTCCTCATCGAGCTCAACACGCCACTAGCCCAG
CTGTACAATGACCGTTCTGTTCTGGAATCGTTTCACTGTGCAGCCTACTCCCAGATTCTGCGGCGGTACTGGTCCGCCGC
CTTCTCCGACACGAAAATGCGGAATTTGATGATTAGCTCTATCCTTGCGACCGATATGGGACTGCATTTTGATTACATGA
AGAAGCTTCGGGTTGTTCAAGACAAACTTGCTGAGAACCCGGACGAACTTGTACTCGAAGAACAGGTCCCTTTGGCCTGT
GCGCTCCTGGTCAAGTGTGCTGATATCAGCAACGTGGTATGTACATCGAAGCTCCGCCATGACGGACATGGACTAACACT
GGAAACAGGCCCGGAGACACGATGCTGCTGTTCAGTGGATGCACATCCTCTCTGACGAGTTCTCCCGACAATCATTGATG
GAGGCCCAGCTGGAGATCAAGTCCTCTCTGCTATCCCAACCTACGAAGGAGCCTGTGACACTCTTTCGATCACAGCTAGG
CTTCATGAATTTGTTTGCCATTCCGCTCTTTCAGGAGGTTGCCAATGTCATGCCCGCGATGCAGTATTGTGTGGACGAAT
TGGTAGTCAACAAGGCTTTGTTTGAGAAGAGCATTGCCGACGAGTTGGTCAAGCCAACCCCGGAGCTAGAAAGAGGCTGT
CCGCTCAGGCTGAACACGGACAGTTCTGCACCTGCAGCAAAAAGACCAGGGGCCACTTCGGGGCAGACGGCAACAGCGAT
ACCAACAGCACAACGGCCCAGAGAGTACTCTGCACACGCAGATGTCAGCGCCACACCCAGACTGATAGGTCTAGACACCC
TGTACAAGGGCGCAAACGGCGCAAACGGGCTGGGCTTGAACTTCGACTCCGCAGCGGTGTATGCAGCAAGCGATCCGTTC
AACTCAATCGATAGCCGGAGCTTCACGCCCACAAATCAGCGAGTGAGCGAGGCCACAGACGGCAGCGCGTCCCTTCCCAG
CGGTGGCGATTGGGCGTCTCAAGCCACCAGCGCAACGACCGGCAAGATGCCACTTTCTCCCAGCACTCAGGGCACGAGCG
TCGTCAGCCGCGACTCGCTGGATCGGCCATCCAGCGTGCCGGCTATTTCTATCAGCAATACGGCCGCCGATGGCCTGACC
AAGTCTCTATCTGGGTCGCGGAGCGCCACACACCTGCCGATCGAAGACCAGTCATCGATGTCGTCAGGTGGACACAGCCA
TGGTAATGGAGGCAGCAAGCTGCAGCCGGAAAGGGGTCTAAAGAAGAAGACGAGTCGATTTAGGTTGAACGCCTTGACTT
TTCTCCGACGGCACCTCAATCCGAGTCCACCTCTTCCAACATCCTGCCCAAACTCTGATAGGTCGGATTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62