GenePrediction:GLEAN_5838 Details

Name: GLEAN_5838
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:651504..646845 (- strand)
Length: 4660
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:651504..651487 (- strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_173:651414..651274 (- strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_173:651209..648678 (- strand)
Length: 2532
Type: CDS
Source: GLEAN
Position: GCSC_173:648524..648173 (- strand)
Length: 352
Type: CDS
Source: GLEAN
Position: GCSC_173:648113..647383 (- strand)
Length: 731
Type: CDS
Source: GLEAN
Position: GCSC_173:647315..646845 (- strand)
Length: 471
>GLEAN_5838 class=GenePrediction position=GCSC_173:651504..646845 (- strand)
ATGGCTTCTTCCGAGCCAGTAAGTTTTTCTTCCAAACCTTACTCCGCCCCGTTGCATCGATCAGCAACGACCTGACACGC
CTTGGACCAGGTGCACCCGCTGCGCATCTCTAAGAACAACGGAATGATACCTTCGCCGACCAAGAAGCTCGCTCCTATTC
CGCGGCCTCTTTCGGAGATTTCTCCGTCAGAGAAGCGGCGTAACTCGCCTAGCTGGAATCAGACGACAAAGGTAAGCTTT
CGCCGTCCCCCTTATCCGTGCATCCGCACCTCCCTAACCAGGTTGGCTGATTTAGAAACTGGGTTTGTCCACCGAGTCCT
CGCCATTTCAATCCTCGCCGCTGGACAGCGCCACATCACCACGCCTGTTCTGGCAGAACCGTGGCGGTTACAACACAGAA
AACACATTCGGCGGCCGTTCGGGATCGCCTTCGCCGACACGCCGTTCTTCTATTGAGCGCCTGCAAAAGGCATCTCGCGT
CAAGAACAGCAGTATCCTCGCTCAGGAGCAGAAGAACGAATACGATCCTACCAAGCTCCCCAGAATTGAACGACCCCTGT
CTAAAATTCAGGGAAATTCGTTTGGTGGCCTCGGTATCATAGGCCTACGGAGTCCCGTCGATTCTAAGCTTCACCAGCGC
AATGGGAGCAAGACTGAGATTCCCTTCTACACTCTAACGAAGACGACTACTTCAGCTGCGACAATCCCATCAGAATCACC
GGTCGAGCACACTTCCGAGCCCCAGCACGTTGCGGCTCGCACTGGTCCCGTTTCGCCAAGCAAGGATCAAGCATCTCCTA
TCAAGTCGTCTCTTTCTAGCCGTTACAAGAGCAACTACGATGAATCCGACCTCAACTTCGACAGCTCTGTGGGCGAGCAC
GATCTTCCCCATGGCACATCCCTTCACCGCCACGCCAAGAGTGTCACCTTCGATGCAGCGCCACCGCAGGTGAACGAGTA
TGAGATGGCTACTCCCGATCTGTCATCGGTCGGCAGCAACTCTCGCGAAGGAAGTTACGAATCTGACGAAGAGGACGACG
ACTACGACGACTATCACTACTCGGGAGGCGATGGTGGTGGCCAGGATGACAGCTTTGATGCGTCATTGGAAGATACAGAG
AAAACTCCAGTTGTCGGTCCAGATGATTGGAGACACGATAGTCCTGCTGTCCGCCAGAAGATGTTTGACGGCAGTCCATT
GCCAGACTCACAACCTTCTGCGGCTATCAGCCAGCATGAAGCAAAAGTGTCTTCTGGTTCCAGTGGCGAGCACAGGCCAC
TTCCCCCATTGCCTGGCTTGCCGTATGCACGCAGCAACTCTGCTTCCTCCCCCCGTCTCTCAGCCACGCCGGAGCGCGTG
CTTGGAGGTAGTCTGCGCGGCTTGCCCTCCCCTCCCTCGCCTGGCGTTACCAAAGCCGATCTCGACAACATTGGCAGTGG
CAAGATGACGCTTGAGGAGCGCTTGAAGCTGATGATGCTATCCGACGATGGCAGATCCGCTGCCGAGCAGCAGAGAGAGC
GTCGCATGAGACGTGCTGGTGGCAGGGACCGCACAAGTAGCCAGAGCCACGAAACGGACGCCGCCGAGCAAGAAGAAGAG
TTGGAAGAGCATGACGACGAAGCGGATGACACCATTGGAGAACTTTCGGGTCTCGAGGAATACCAGCTACCGCCAAGAAT
ATCTCGGGAATCAATTCTTAGACGTGCAAATGGCAGTCTCGCTCCGGCCCGCGACGGAGACTACAACTTTTCGTCCCCGC
CCAGCTCCAGTCCCGAGCGTACACTCCAGCTCGATCCGGATGTTCCAATCCCAAGCACGGAGCATGATGATGACAGTTTT
ATCAGTGACGAGGACGGGGATGACCTCGATGCTGATATATACGACACATCAGACACTTATACTAGCGATGGCGAAGACGA
GGAGGACCGGAGTATGATTTCGGAGAGCGATGCTGTTGGCGATGAGCTTGATCATGAGCATGATCATGATAATGAGACAG
ATGGCGATATCATCGGCACTCCGCGCGCTGCCACACCGATCCAGGAAAGCGGCAGCTCGCATGTCGTGAAAGAAGATGAC
ATTCTTCATGCTCATGATTTATCAACTGCCACCAAAGAGACTCGTGTGTCCTTGCAAGCCATGGTGGATTCAGACACCCC
AACTGTCACAGCAGAGGCGGCGGTGCCAGGGATCGAAAGTGCTCGAGCTTCGACACAGCGTGCATACACGCCTACCCAGG
AGCATCCCTTGTCTAAGCCTGAGTATGATGGGACTGGTTGGGGAGATGACGATGAGTATGATGAGCCGGGGACGCCAGAG
TCGGTGATCCACCATCCGGTGGACCACTATGAAGATGATGACGAAGAAGATATCTACGAAGATGAACAAGAGCAAGAGCA
AGAGAACGATGAAGAGCACGAGCATGAGTATGAACGCGAGCAAGATCACGAACAGAGTCCAGAGGTGGAAGACCACGAAG
ATGAGCATAGTCTGGAGTCGCCGTCCGTTCCGGAGCGAGTTGCAACGATCAAAGCGTCCGGCTCGAGGCTGAAGACACGA
CCTTCGGCAACGCCATCTGATATTGAAGCTATGCGCGAGGCTCGGCGGCAGGTCAGCCGCGAAATACCGATAGTGCCCAC
AATCCCAGATCGCCACCGCAACCGGCTTTCTCGTGACATGGGTGCCTCAGAGGATGAGGAGGGCGAGCTGGAGCAGGGCC
ACTTTTTGGAGCGACATCCCAGCTTTAAGAAGAGCAGTCTGACGCTGGATCTTGGTTTGGATCTGAGCCTTGACAAGGAC
TTTGACCGCGTGATTGAGGCACAAAAGGTGGCTTACCATTTTTCTTATCCGTCTTCAACTTCTACCCGAGTCGAACTAGG
ACAAGCGTCAAGCCAGGCGTCTAGTGACGACAAGGGCACTCGACAGGAAAACCGGGGTTTGTATGAAGGTCTTGATACTA
ACGTAACACCACGGAAACAGCGCGGATACCTTATGCGGCAGAACACGAAGCTCGTTGCTGCCAGCGACAAGGATGGTGAT
GACTATCGTGGTACACGCTCAGCCGGCAACTCGCCGGTGAAGGCTATTCGGCCGCAGTCGTGGACGGTAGAGCCATGGAA
CGGTCAGGCGAAGAGGAAGAGCATCCGAAAGCGGTCGGTCATGCCTGGTCCTGTGCCGCCACTCCCTGGGCAGGCGAGCA
ATGCTGTTGCTCCGAATGCTCTGGGAGAGGAGGACATCCTGACGGACTTGCCGAATGACGAAGGCGCAGAGCGCGGCCGT
CTGTTTGTCAAGGTGATGGGGGTCAAAGATCTGGATCTTCCGATCCCGCGAAGTACGTGGTCTCTACGGCGGTGCGATCG
AACAAGGTGACAGTTTACTGACAAGTTACAGCGGAGAGAACGTGGTTCAGTTTGACACTGGACAACGGCGTGCATTGTGT
GACGACTGCGTGGCTGGAGCTCGCGAGAAACGCGCCAATTGGGCAGGAGTTTGAGCTTCTCGTTCCCAATGAGCTGGAAT
TCCAGCTCACGCTCAATGTCAAGCTGGAGAAGCCGCTGGTGGTGAAGAAGACAATCCAGCCAGCTCCTAAGGCTGTGCGG
CCGAAGGCTTCCACATTCAGCCGGGTGTTTGCGTCGCCGAAGAAGCGGAAAGAGATGGAGCTCCGGATGCGAGAGGAAGA
GGAGCGAATGGAGCGCGAGCAGCGCGAGGCACAGGCACGGCTCAAGAGCGCCCATCCGACGTCATACGACCTGCTATCGC
CGATTGTGGCGGAGGACGGAAGCTTTGCGCGGGCATATGTGTGTCTGAAGGAGCACGAGTCGCGGTGCTACGGCCGTCCG
GGGATCGTGGAGGTGGCGTGCTTCAACGAGTGGGCAACGGAAGAGGCGAACTTTGCGTGCAGCGTGAAGAGCAAGCGGGG
CAACGTGGCGGTTGTTCGGAAGGCGCCATACAAGATTGGCAAGCTGGAGCTGCAGCTTCTGTTTGTGCCGCGGCCTCGGG
GAGTGACCAACGACGACATGCCGAAGAGCATGAACTCGTGCATCCGGGAGCTGAAGGCGGCAGAAGAGCGGCTGTCGCGC
AACTGGGAGGGCCATCTGAGCCAGCAGGGCGGCGATTGTCCGGTAAGTGGACGACTGGAAGGAGGCTGAAAGTGTGGAAG
TGGTTGCTAACGACTGTTCTTGGGTCTAGTACTGGCGTCGTCGTTACTTCAAACTGGTGGGAACGAAGCTGACAGCCTAC
CACGAGGCGACTCGACAGCCGCGGGCGACGATCAACCTGGCGAATGCCAAGCGGCTGATTGACGATCGGCGGGCGCTGAC
GGAGAAGGAGACGACGGGCAAGAACGGTAAGCGTCGGCGGTCAGCGTTTGCGGAAGAGGAGGAGGGGTATATGTTTGTGG
AAGAGGGATTCCGGATCCGGTTCAACAACGGTGAAGTGATCGACTTCTACGCAGACACGGCCGAGGACAAGGCTGGCTGG
ATGAAGGTACTCGCAGACGTGACATCGCGCGACAGCATAAGCAGCAATGGCAGTGACGACGAGATGAGCTCGCGTGGGCG
AAGCAAGTGGTGCGAGCTAGTGTTCAAGCGCGAAGAGACGCTGCGTCGGCGGGCGGAGGGACGGCGGGTGACATCGCGGA
CAAAAAGTATGTACGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62