GenePrediction:GLEAN_5839 Details

Name: GLEAN_5839
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:645436..644295 (- strand)
Length: 1142
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:645436..645344 (- strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_173:645293..645033 (- strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_173:644966..644295 (- strand)
Length: 672
>GLEAN_5839 class=GenePrediction position=GCSC_173:645436..644295 (- strand)
ATGGCCACCGTGTTGGGAAAGCGCAAGCCGGCGTCTGCATCGGCGACAAAGGCCGCCAGCGACAACGACCACGACGGCGA
CACCATCCAAGACGTCTTCCGGCGCCACTTTGAAGCGCATTTCAAGCCCGCCTGCCAGGACAGACGGCAGCCAAGAAGGC
GACCAAGGCCAAGACGACGCGCGAGACGACCGTGTCCGATGACGAGCGCTCGGACTGGTCGGGGCTCTCGGACGAGGACG
AAGACGGCGAAAGCGAGAGGGTCAGCAACAGCGACAGCGAGAGCGATGGCGCCGAACCAGTCACGCCTTCCGTCCAGGTG
ATTGACTACAGCAGTGGTGCCTCGGCTGCCGATCTGGCCGGCAACGTCTCGGGCATGACAAAGCAGGAGCGCAGAGCCTA
TCTGGTGGGTTGCTTTTCTGTTGGTTGCTGTACAGCGCAGCCGATCGAACTGCTACTGACGACACGACAGTCTTCCCGCC
CGCCGGCCCTCGACGACCGCCGACGATCCGCCAGCACGACCACGGCCGCTGACACGGCTGCTGCCGACGGCGCCGACGGC
GCCAATACCTTCAAGGACGCCCCCGACCTGCTGGCCAACGATCTGGCGCTGCAGCGGCTCATCGCCGAGTCGCATCTGCT
GTCGGCCGTGCGGGCTCCCTCCACCACAGGTGCCGATCCAGCCTCTCTCAAGAGCGCCCGGCCCTTTGCTGCCGGCCGTC
TGCGCCAGCATGCCACCGACCTCCGCATCCAGGCCGTCGCTCGCCGTGGCGTCAGCGGCTTCGCATCTTCCCCCGCCGCC
TCGGCCGCCTTGGCTGCTCCCCCTAACTCCGCTCACAGCATCTACACCCAGACCTCCATGCCCATGGCCATCCGCAAAGG
CATCTCCGGCGCCGCCGCCGCCCGCGAGTCCAAACGCCGCCGTGAGGCCCGCGAGAGCGGCATCGTCCTCGAACGACCCG
CTACTATTTCTGCTGCCTCCTCCTCCATCCGTCGCCGCCGCCAACGCGCTGTCGACGCACCCTCCGTCGGCCGTCTTCAT
GGCTCGGAGCTCCGCCTCCGTGAGAGCGACGTCCGCGCTATCGAGGGCCACCGCTCAGGCTCCTCTTCCATTGGCCACAA
AAAACACAAAAAGCGGAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62