GenePrediction:GLEAN_583 Details

Name: GLEAN_583
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:734860..735964 (+ strand)
Length: 1105
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:734860..735838 (+ strand)
Length: 979
Type: CDS
Source: GLEAN
Position: GCSC_97:735891..735964 (+ strand)
Length: 74
>GLEAN_583 class=GenePrediction position=GCSC_97:734860..735964 (+ strand)
ATGAGATTGTTCCTGAGCCGGATTTTGGGCGCCGCCCTGACGCTGGCCACGGCGACGACAGCACGATCCTGCCGCCCAGA
CGTGCAGCAGGCGAGCGTGACAGCGGTGGCGGAGCTGGGGACGCCGCCGAGCTGGGCAGAGAACCTGGCGTTCCGGCCGG
ACGGCAACTTGCTGGTGACACGGCTGTACGAGCCGGCGCTGTACCACGTGGACGTAACGACGGGAGCGGTGGTGGAGGTG
TACGCATGGAACGGGTCGGAGCACTTGGGCGTGCTGGGCGTGGGCCAGACGACGGCAGACGTGTTCTACGTGGCAGTGGC
GGCGCTTGTGGACCTGACGACGGGGGCGACGGTAGCCGGGGCCAACGAGATCTACCGCGTGGACATGCGGCCGTTTATGC
TGACAGACGACGGGACAGCAGTGGCGAATGCGGCCGTGGTGACGCGGGTGGCGACGGTGGAGGCGGCCGGACTCTTCAAT
GGGCTGGCGGTGCTGGACAAGCGCTACCTGCTCGTGGCCGACTCGATCGGCGGCGTGGTCTACGGCGTGGACGTGCTTAC
GGGCGCGTATGGCGTGGCCGTCAACGACTCGCTGATGAGTGTCGGCTACGCGGCGTACCCGCAGTCGACGCTCGGCATCA
ACGGCGTCAAGGTCTACGGCGACCAGCTGTACTGGACCAACTCGGCAGCCGGGCTGCTGGCCCGCGTGCCCATCAACCGG
CTCGGCCAGGCCGTTGGGCCGGCATCCATCGCCGTTGCCGACGTCGTGCCCATCGATGACTTTGCCATTCGCGGCGACGG
CGTCGCTTTCCTCTGTCAGAACCAGCTCAACACGCTCAGCGTCGCCTACCTCGACGAGCGCCGACCCGTCACATCCTTTG
CCATTGCCGGCAGCAACGGGTCGACCGTCCTGGCTGGCGTGACGGCTGCCATGTTCTCGCCGTCGCGTCCGAAGCGGCTG
TATCTCTCGACCAGCGGTGGTATGTATTGTTTGTCTGAGTCCCTGCAGTGCTATTCTGACAAGACCCATAGGTCTCGCAG
CTCCTATCAACGGAACGGTCACGGTCTCTGGAGGCGTGTCGTACATTGACACGACGGACTATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62