GenePrediction:GLEAN_5840 Details

Name: GLEAN_5840
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:631475..629790 (- strand)
Length: 1686
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:631475..631406 (- strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_173:631355..630574 (- strand)
Length: 782
Type: CDS
Source: GLEAN
Position: GCSC_173:630511..630191 (- strand)
Length: 321
Type: CDS
Source: GLEAN
Position: GCSC_173:630128..629790 (- strand)
Length: 339
>GLEAN_5840 class=GenePrediction position=GCSC_173:631475..629790 (- strand)
ATGGCATTCTTTGAGAACTACCGGGTCTATGTGCTCGCGTCGGTGGCCTACCTGGGCTCCTTTTTGTTTGGTGAGCGTCT
CCTGGCGGACAAGTGACAGGTGTCTGTGAAGTCTGTGCAGCGGTGCTGACGGCGTCCCGAGGCTACGACACGGGCGTGAT
GGGCAGCGTGCTGGCGCTGACGAGTTTCCGGCGGGACTTTGGGCTGCCGACGCAGAAGTCGGCCTTTTCGACGTCGCGCA
ACGCGGCCATCTCGGCCAACGTCGTCTCGCTCCTGACGGCCGGCTGTTTCTTCGGCTCGATCGCGGCAGCCTTTCTGAAC
GACCGGTTCGGGCGACGTCGCACGCTCGTCTTCTTCATCCTCTGGTTCCTCCTCGGTGCAGCCGTTCAGACGGGTGCGCG
CCACTCGATCGGACAGATCTATGCCGGCCGCGTGCTGGCCGGCATCGGTGTTGGCGGCATGTCGGCCGTGACGCCCGTGT
TTGTGACTGAGAACGCGCCGGCACGGCTGCGTGGCCGCATCGCCGGCCTCTTCCAAGAATTTTTCGTCATCGGCAGCACG
TTTGCCTACTGGCTCGACTACGGCGTCGCCCTGCACGTGCCGGCTGGCACTCGTCAGTGGCGCATCCCCGTGGCCCTGCA
GCTCGTCCCGGGCGCCCTGATGCTGGTCGGCCTCTGCTTCCTCAAGGAGTCGCCGCGCTGGCTCGTCCGTGCCGGCCGCC
ATGATGAGGCCCTCGCCTCGCTTGCCTACATCCGCAATCGGCCGGCCGACGATGTGGACGTCGTCCGCGAGCTCGCCGAG
ATCCGCGCCTCCCTCGACGAGGAGCTCGCTGCTACCGAGGGCGTCACCTGGCGCGAGTGCCTCCTCGTCCCCCAGAACCG
CCTTCGCTTCTTGCTCGCCTTCGTCATCATGATCTGCCAGCAGTTCTCCGGCACCAACAGCATTTCGGCTATTATGCCCC
CGAGATCTTCGAGAGCATCGGCGTCAGCTCTACCCACGCCTCCCTCTTCGCTACCGGTATCTACGGCACCGTCAAGGTCG
TCACCACTGCCATCTTCCTCCTCGTCGGCATCGATTTCTGGGGCCGCCGCATATCCCTCATCTGTGGCGCTGTCTGGATG
GCTGCCATGATGTTCATCATCGGTGCCGTTCTGCATACCCATCCCCCTGACACCTCCAGTTCCGTCGTCTCGCCTGCCTC
CCAGGCCATGGCTGCCATGATCTACCTCTTTGTCATCGGCTACTCGGCCTCCTGGGGGCCGACCCCTTGGGTCTTTGTCA
GCGAGGTGAGTCAGATTGGCGCCATTGCGAACAAAAATGATCCGTCTCTTAATTGCTGACTCATCAGATCTTTCCCACCC
GTCTTCGTCCTTATGGCGTCGGGTTGGCTGCCACCACTCAGTGGCTCTTCAACTTTGTCGTCACCGAGTTCACGCCCTCG
GCCGTCAGCAACATTGGCTACCGTGTCTTTATCATGTTTGGCGTCTTCTCTGTCGCCAACGCGCTCTTTGCCTTCTTTCT
CGTCAAGGAGACCAAGGGCCGCAGCCTCGAGGACATCGACATCCTGTTTGGCAATGTTTCCGAGGAGCAGCGCCGTGCCG
ATGTCGACCAGGTCTTGCACAAGGCCGGTGCCGACCACGTTGATGACAAGGCTGTTGAGCTGGGCCCGGCGGAATCCCGC
GTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62