GenePrediction:GLEAN_5841 Details

Name: GLEAN_5841
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:627086..621328 (- strand)
Length: 5759
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:627086..626710 (- strand)
Length: 377
Type: CDS
Source: GLEAN
Position: GCSC_173:626642..625540 (- strand)
Length: 1103
Type: CDS
Source: GLEAN
Position: GCSC_173:625466..621328 (- strand)
Length: 4139
>GLEAN_5841 class=GenePrediction position=GCSC_173:627086..621328 (- strand)
ATGGCGACATCTCTCGCCGCGCAGCTGGCGCAGATTGCGGCCAAGTCCAAGATTTCGCTGGACGTGAAGGCGCAGAAAGC
ACTGCATGGCAAGTCGCTCATCTTTGAGCCGCGGGTGGCGGCAGCACAGTCATTCCAGACGGTCTTTGCGATATGCAGCG
AGGGCTTTGACGAGCTGTGCCAGTTGGACGAGCGGTTTGTGCCGTTTGCCGACACGCTCTTCAACGAGCTGAGCCAGGAC
GAGGACCGCACGCAGATGACGGAGGCGGAGAATGCGGTCCTGGACAAGAAGATTGAGGCGTTTCTGCGTCTGGCCGGGGC
GCGGCTACGGCTGCTGCCGGCCATCAAGGCGATCGAGTGGCTGGTTCGGCGATTCCAGTGAGTTGGCTGTTTCTGGTGCT
GCTCTTGCGTCGGAAGAGCAGAACTGACGATTGGCAATCCACAGGATCCATGAATACAACACGACAGCAGTGATCACGAC
GTTTCTGCCGTACCACTCGATACCGGTGTTTGTGACGCTGATGTCGATTTTGCCGACGAACCTGCCGCACGAGTACCGGT
TCCTCAGTCCGTACGTGCGATCGCTGACAGGGCCGCCACGAGCGGCGATTGTGCAGCATGCGACGCAGCACTTTGAGCTG
CTGGTGACGCTGTCGGCGTATGCGCTGACAGCAGCACGGGCGCAGCAGCACTACGGCGGCCTGGTGACGTTCTGGGGCGG
GGTGATGACGGAGGCCGTCAGCGGGATGCTAGACGGGCTGCGATCGGGCCACAAGAGCGTACAGTCGGACAACACGCAGA
CGGTGCTGCAGCGGATGGGCCCGATCCTGGGCGAGGCACTGGTCATCAGCCGGGCACCGGGCATGCAGGTGGCGGCGTAC
ATGGTGGTGGCGGTGTTTGTGAGCAAGGCCAACCTCGGCGACGCGGCCATTACGGCGTTCATGGAGCAGCTGGTGGTGGG
CTGGACGGCCGAGACGGCCAAGCCGGGGCTGGTGTGTCTGGCCATTCTGGCACAGCACCGGTCGGCGCGCCAGCTGTCAC
GCAAGGTAGCCAAGGCGGTGCTCCGGGTGGCAGACCTGGCAGCGTTGCTGGTGGAGATTGGGCGGCAGCGCCGGGTCGAC
CGGCTGGCCAGTGGCCTGGTGCTGGCACTGACGGAGCGACTGGCCAAGAAGGCGGCAGTGCGCAGCCTGCCACTGATCAA
AGCGATTCTGCTGGGCGGCGTGCTGCACGAGAAGCAGCTGGCGGTGGCGTTCAAGGCGCTGCTGCTGGCCGCCCACAGCA
TTACGGACGAGACCGACCCAGCCGGCACGACACGCAAGGAGCTGGGAGCCATGCTGGTGGTGCTCTCGCAGGGACAGGCA
GAGGCCGGCGGCGACATTATCCGCCGAGTGATTGCAGACGTCGACCTGGACATTGAGGAGCTCGAGCTCAAGTTGGACGC
CACGTTGCGGCCGCAGCCGGTCTTGCTGCTGGCAAACGGGGATGGCGAGGCGGCCGGTGACGACGAGGCGGCCACCACAG
CGTCTCCTACACTCGACGCGCGAAGACGTCGACACAGCGATTCGGCGGCTGGCGCAGCTGCCGCGGCCGGCGTCCTGCCT
GGCTGGCGAACCGGAAGGAGGATTGGTGGAGCAGCTTAGTCAGCTTCTACTATCGGCCGTGGCGGCGGGACAGGCCGAGC
TAGAGCAGCTGGACAGCGCGCCGCTATTGGGCCGAGCGGACGCAGGCTCGGACTGCTTCTACTTCAGCTTCCTGATGCGC
ATATGGTCGGGGCCCTACCCGACACTGGCGCGCGTGGCAGCGCTGGACCGCGCAGCCAGGCGGCTGGGGCTGGACGACTG
CACGGACGTGGACTTCCAGGCGCTGCTGCCGTACTGCGTGGTAGCGATGGGCGATCCGGCTAAGAAGGTGCGGCGGGCAG
CCGCGCAGGTGGTGTCTGCGGTGGCGAAGCTATCTGAGTCGTCGACGGCAGCCGCCGGAAGACAATGGGGCACCACACAG
CTATACGAGGCGACGGAGAGTGTGAGGCAGGGCGCGGACGCGAACACGGGCTTGTGGCTGTCGACGGGAGCGCGCAAGAG
CCTGCTGGACCTGCTGGGCGGATCGGCCGACGAGGCGGTGCTGCATGAGGGCCAGCTGTCGGCAGTTCTTAGGGACGCGA
TGGATAAGTCGTCGTCGTCGTCGTCGGGCCAGGGCCAGGGCCAGGGCCAGGGCCAGGGCCAGACCCATCTATCGCATGGG
ACACGGCTGGCGCTGCTGCGGTTCCTGGCCGGCCACGCGGTAGCGACACCGCTGGTGGGCGTCAAGCTGCGACTGCTACA
AACGATCAACGAGGTGCGCGGCGTGTCGGGGACGACGAGGACGCAGCTGCTGCTGCCGGTGCTGCAGTGGTGGGCGGGCC
TGAGCGCGAGCGAGGCACAGCAGGCAGTGATCCGGGCTGCCGTGGACGAGTCCGATCTGGATGGTCGCTGCGTGGACGTG
GTGGTGGCCAACGATAAGGTTGGACTGGAGTGCTTGTTGGCCGTGGTGCAGCAGGGGAAGACGATGACTAAGCGAGTGGG
TCTCGTGCGAGCGGCTTTTGGGCGAATGCGCAAAATGTGGCCAGCGATGAAGGAGGATTTCCGGGCGGTGACGGCGGAGC
TGTTGCTGGATCTGGTGATGGCAGGGGAGGGTCCGGACGAGGAGGCGGACGAGGGACAGAAGCTCGTATCGGAGGAGGCA
GCCGACGTGCTGCAGCAAGTGGAGCTGAGCAGTGCCATTCTCGCGCGCTTCCTCGACGGCCTGCAGCAGCACGCGGCCAA
GATGGCGAGCGGGCCAGCGAGCAAGCGACGACGGACGAGCTCGATGGGAGCGGGGAGCGGAACGACGACGATGACGACGA
CGACGACGGGAACAACAGGAACGGCAGGCGAGCTGCGAGCGATGCTGCAGCAGACGACGTTTGTGCTGCAGCTGGTGCAG
GGGTCACATCCGGAGGCGCACCCGACGCTGCTGCCGGCACTGTTCGCGGTGCTGTCAGATCTGCAGGCGCTGCGGTCGGT
GGTGGGCTCAGAGCTGGGCTACCTGCAGAACGTGGTGCTGGGCTGTCTGCTGGCGATGATGCCGGCCTACCAGGCAGACC
GGCGGCTGCGGATTGCGCCCTCGGTCGGACACGGCGACGTGCTCGTGAGCTGCATCCACAAGTCGAGCTCGCCGGCGGTA
CAGAGCACGGCGCTGCTGCTGGTAGCCAGTCTCGCGCGCACGGCGCCCGAGGTGGTGCTGCACAGCGTAATGCCCATCTT
CACACTGATGGGCGGGTCAGTGCTGCGGCAGGCCGACGACTACTCGGCGCACGTGGTCAGCCAGACGATCCGCGAGGTGA
TTCCGCCACTGATCGAGACGTTCCGCCGTGGCGCCAGCTCTGGCTCGGGCGTCGTCGCCCGCGCAGCCGAGCTGCTCTCC
AGCTTCGTCATCGCCTATGAGCACATCCCGGCGCATCGGCGGCGCGATCTGTTTCTGTCGCTGATCGAGCACCTTGGCCC
GTCCGAGTTTCTGTCGGCCGTGCTGGCCATGTTTGCCGACCGCTACGGCGCAGCTGACGACAGCGACGTGGTCGCCTTTC
TGGCCGATCTTACGGGTGCCTTTCCGGCAGCCGTGCAGCTGCAGGCGCTCGTGCAGCTCGTCGGGCTCGCGAGCGACGTG
TTTCAGCCGCGGCCGGCCCTGGCGGCCACGCTGCTCGGCCGCAAGGACGACAAGACCGGCAAGACCAGCACGGCCAGCAC
GACAGCCACCAACGACCTGCAGCCGGCAGCTCTGCAGGTGCTGACGCTGCTGCCACAGCTGCTGGCCAGCCGACGGCTCC
GCGACGCCGTCGGCCGGCTGGACGAGGCCGACGATGACATGGAGACGGCCAAGATCCGCGAGCTGTACGCGCAGCTGCTC
GAGGACGTCCTAACGCTGGCCGGCACGATCCAGGGCCGGGAGCGCAGCCAGAAGAAACCGGCCACGGTGCTGGGCGCGCT
GCACGGCCGCTGCGGCGACGCGCTCGGCCAGCTGCTCCGGCTGCAGTCCATCGGCGAGTTCCTCAAGGCCGTCGAGACGC
TGCTGGACCGGCCCAGCATGGGCGTGCGCCAGCAGGTGCTGCGGGCGCTCGAGGTGCGCGTCGACGCCGAGGCCGCCAAC
AGCCCGCAGGCCCGCACGGCGCTGCTGGCGTTTCTGCCGCAGCTCACCGCCGTCATCCGCGACTCCGACGACGTGGCCTA
CAAACATACCGCCGTCACGTGCGTCGATCGCATCGCCGACAAGTACGGCAGGCGCGACCTCGAGGCCGTCACGGCCGCTG
CTGCTGCCATTGCCGGTGACGGCTGTCTCGGCCAGCCGGATCGCCGCCTGCGCGTCATGGCCCTGCTCTGTCTCGCCTCG
CTCGTCGACGTGCTGCAGGAGGCCGCCGTGCCTGTCCTGCCGGCTGCCGTGCCGCGCGCCCTGGCTTGTCTGCGCGAGAG
TCTGGCTGCTGCCAGCCCGGATGCCCAGCTGCACAATGCCGCCTGCTCCTTCGTCATGGCCCTCGCCCAACATCTGCCCT
TTATGCTGACGGGCGCCGACCTCGACCAGCTGCTGGCCTGCTCCTTCATCTCGGCCGAGACCGTCTTTGTCCCCGGCCAC
AGCGACACCGACGACGACGACGCCGCCGCCGACGCCGCCCCCAGCCGCCGCCACTGTCTCCAGCTGCTGGCTCGACAGGC
CGACGCCAGCGTCTTGTTCGACGTGCTGCGTCGCAGCTGGCCCGCTGCTATCGCGGCTGGTCACCGGGCCACGCTCGAGT
GCGTCCACGTCCTCACGGCCGCCATCGATCGCCACACCAAGTCCACCATTGTCAAGAACCTGCCGGCTCTGTCGGCCATC
CTGCAGGCCGCCTGCGACCTTCGCCGCGAAGCTCGTCTCGACGTCGCCGCATCGACACCTGTCGCGCCCTCTGTCCTTCC
CCACGTGTCGGCTGTCGAGACGGCCGTCCACACGGCCGCGCTGCACATGGTCTTTAAGCTCAACGACGCCGCCTTCCGTC
CCGTCTTTGCCGACCTGATGGCCTGGTCCGACCGCGGCCTGCTGCCCCAGCCTGACCGGCTCGGCCGCTGTCTGCGCCAG
CAGTCCGTCTATGGCTTCTTGCTGCTCTTCTTTGACCGCCTCAAGTCGGCCGTCACGTCCTACGCCGCCTACGTCACCGA
TGGCGCCGCCGCTGCCCTGCGCACCGCCCGCGTCGCCGACAGCGCTGACGACCGCCTTCTCTGGACGCGCGTCCTGCAGA
CCCTGGCTTCCTGCTTCGCCCACGACGTCGACAACGCCGGCGGCGACGGCGGCTACTGGCAGGTGCCTGCGCACTTTGCC
GCTGTCGCGCCTGTGCTGGTGGAGCAGTTTTCCCGAGCACGTGACCTGACCGAAATCGAGCCAGACGACCAGGAAGGAGA
GCCTCTCACCCATCTCACCCATGCTGTCGTCCAGCTCGCCCGCGCCGCCAACGCGCCCGAACACCACAAGGAGCTCAACG
GACTGCTCCTACGCCGCCTCCGCTCGCCCCATGCGGCCGAGCGGCTCGCCGTCGTGCGCTGCCAGCAGGCCCTCGCCGAG
ACCGTCGGCGAGGAGTGGCTCGCCATGCTGCCCGAGATGCTGCCGTACATGAGCGAGCTGCAGGACGACGACGACGAGGC
TGTCGATCGCGAGACCCATCGCTGGATCAACATCATCGAGGGCGTCCTGGGCGAGAGCCTCGAGACGATGCTGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62