GenePrediction:GLEAN_5845 Details

Name: GLEAN_5845
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:609755..604617 (- strand)
Length: 5139
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:609755..609690 (- strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_173:609483..608974 (- strand)
Length: 510
Type: CDS
Source: GLEAN
Position: GCSC_173:608907..604861 (- strand)
Length: 4047
Type: CDS
Source: GLEAN
Position: GCSC_173:604799..604617 (- strand)
Length: 183
>GLEAN_5845 class=GenePrediction position=GCSC_173:609755..604617 (- strand)
ATGCTATCGCCCCCCGACGGGCAGAATAGCATATGGCCCTGCTATTCATGTTGCCGGCAGGTGTGGGTATGTTACTGCAT
AATATCGCTTTTCCCATTCCTCTTCTCTGTGGAATAGCATCGCCAAAACTTCGGATGGAGATCCTTCCACAAGAACACGT
TTTGTTACCCAAAAAGCTGCACCCCACACCTCCAAATCAGGCCCCCCACATTTGCTGTTACGCAAGACGCCAATTCCAGG
TTACCCTGTACAGGAACTGACAGCATGATCAGGTACCCGAGACTGCTGCGTTCAGTGATGGCTGCCCGGGTTTAGTGGCT
TACATTCCGGCCCTGGTCGCAATCGTCGTCGTTCTTGGCCGTTACAGCCTGCGTCCACTATGGCGGCGGCGTCCCATCTG
GCTGCGCGATTTTGCTACCGAAAAGGATGAGTTGGGCCCGGCCACGGGCTGGTCTTTGCCTGATGATGACGAAGCTGACG
AGGAAGAAGAAGCTGAAGCTCCTTTCTGCAACAGACCGTCACTGGCTGTTGAACCAGATTCATTTACCGGGAGAAGCATC
GAGTTCGGGACTACAGCTGAGGTCATCAGTAATAACGACAGCGATGACAGCAATGAAATCACCATTGTCAGTCCTGGCAA
CAGATTTACGCTGTCCAAGATCCGGATATGGACGATGGAAGTAACACTCTTTCTGCTGTCTCTCATAGGTGTTATCACTA
GCCTGCTCCTCACGTTTGCAGCCGGGTTGGGCCTGCTATACCTAACACCCCTTGTCCCATGCGTGCGTATATATGAAGTG
ACAATTCTGTTATCGCCTAAAAATTCGCCGAGCTGACAACTGGGGCAGCTTGCATCATGCTTATTGCTAGCCATCGATCG
TCCTCGCACGCTGCCAGGGGCCGTCTACCTGCTTCACGCGGCCACTTTGGCCATTCAACTGGCCCTACTCCTCGGTGTAC
CTGATCTCTACCGCTGGCCTTTGTGCCCACTTTGGCTTTCTGAGATCAGCGTGACTGGGCTGTCTCTGGCCATCATGACC
ACCATGCCCTTGCGCGATCCCAGCCTTGGCAACCGTGCCTCTGGAACAGACGGCGAGACTATTGCTCTGCCCTTTGAGAC
ACCCTCGAACAAGCTCCGCAGCCCCGAAGACGCCCTGACCTTGTGGCAATGGATGACTGTTAGTTGGATGGGGCCTCTCA
TTGGCTTGGGATATACCCGGCAGCTGCACAGCGAGGACGTCTGGAACCTCCCCTATCAATTCCAACATGGGCGCCTCTAT
CGACTGTTTCAAGACGTCAGGGGAACCGTTACTAGTCGCGTCGTCAAGGTCAATACCCCGGATCTAATCATCACATCTGT
CCTCGGAATATTGGATTCTCTTCTCTCGATGCTCCCGATTGTCTTTCTCAAGGCACTCCTGGCTTCCATGGAGGGCTCCA
ACCCCAACGTGCGTGTGGCTACGATCTATGCGGTTCTCATCTGCATTACAAACCTCCTTCGTTCTCAATGTGGTGTCTTT
TCGCTCTGGTATGCACGTCGCTGCTACGAGCGGTCGCGTGGTGAGCTGATCACTATGATCTACGAAAAGACGCTGCGTCG
AAAGGCTTTTACGTTTCCAAGCCATACAGATGCAAGCACGAAAAACGGAGGCGAAGTTGCCGAGGATCTTGTACAAGGTC
CTGCCTCGACTGGCAAGATTCTCAACCTCATGCGAAATGACGTCTACGAGGTGGCCCAGCGCTTCTGGGAGTTTCCCACT
CTGTTTACGAAGCCGCTCAACTTTGTCCTTTCCATGGTACTTCTTTGGCGCATTCTCGGAGCTGCCTCCTTAGTTGGGAT
CCTTGTTGTTGTCATGGCACAGCTTATCAACGTCTTTGTTATTCGTATCCTTGTCAGATGGGAGACGGCCCGCCGAGCTG
TAACCGACATCAAGCTTCAGGTGACCTCGCAGTTTATTGAGTCGATTCGACACTTACGCTGGTATGACTGGCAGGACAGG
TGGCTGGCCGACATCCTGAAAGCGCGACAGAAGGAATTACGTTACCGAGTGATTACCAATATTATTCAACGGATCATCAG
CGTTGTCAACCAGATGTCTGCCAGTTTCTTCCCCGTGGCGGCTTTTTACGCCTATACCGTCTGGGAGAGGCGGCCTCTAA
CAGTGGACGTGGCCTTTCCTGCCCTGAATCTATTCAACCTGCTTGAACAAAGTTTGCGCGAGTTACCTGATCTCATTACG
GTGCTTTTGAACGCCACCGTTGCCATGCGCCGTATTGATGCGTTTATGAGCGAGCCAGAAAAAGAAAGCGATGGTGCTGC
TGATGTCATACTAAAGCAGGCTCCCGGAGGCGCCATAGTGGACGGCATCTTGCGCCCACCTGGTCCCCTCCACGTGGAGA
TCACCGACGGATCTTTCTCTTGGCCAACAGTGAAGAAGCCTGTACTGACAAAAGTTGACTTGATCGCCGACGGTGGCAGT
TTGACCGTCATCTTTGGAAAGGTCGGCACCGGTAAGACGGCTTTGCTCATGTCTATTCTGGGCGAGATGGACCAACATAG
CGGCACCCGTTTTGTTCCTCGAGAGACTATTGGTTACTGCGCGCAGACACCCTGGCTCCAGAGCATGAGTGTGCGTGAGA
ACATCCTCTTCTGCACGCCGTTTGACGAGCAGAGATACAATAGCGTCGTCGAAGCATGCTGCCTGCTGCAGGACTTTTCC
GAATTCGAAGCGGGAGATATGTCAAACATCGGCGAGAACGGTATCGGCTTGTCGGGCGGCCAGAAAGCCCGAGTTGCTTT
GGCACGCGCCGTCTACAGCCGTGCACGCATCCTGCTTCTCGATGATCCTATTGCGGCCCTAGACCACAACACGGCTGAAT
CGATCATGAAGAAGCTCTTTACAGACTCGGGGCTCATGCGAAACCGACTGGCACTTTTTGTCACGCATCGCTTGGATCTT
GTTGCCGGCTACGCGGACCAGATCTACGAAGTCAGTGACGAGAACGGCATCGTAACAAAAGTGGATATCGGGACAGTCAG
GAAATCGGCCGGCGTTTCTGCAGCTGCGCCAACAACAACGGCGGACAGCGAGGGAAGCAGTGCTGCTGACGACAACGAGG
GCGATTCGTCACCGGAGAACAATGTTGCGGGCAAACCTGCGTCAACTACGAATGGCGCCAACAAATTTATCGAAGAAGAG
TATCGCGCCCACGGTGGGGTCATGATGTCTGTGTATTGGCGGTATGTCAAAGCCGGCGGCCTTCGGTGGTGGGTATTGAC
ACTATTCACGTTTATCGGCTTCCGCATCGCGAAAATTGCGTATCTCTATTTTCTCAAGATATGGGGCGAGGCCTACGACA
AAGACGCCACGGCTGATGCTGCGATTGAGGCGACACTGACGCTTGTTCCAAGGGTGTTTACATATCTGCAACCATGGAAA
CAGCTTTTGACTTCTGGGTCACATGGCGACGAGGACATGTTCTCTATCGCGACGGTGGTGAATCCGGACAACGCAAACAC
TACGGGCTGGTATGAGGGTGACTTTGGACTGCCCTCCCCCATGACCAACGTTGTGCCATGGCTTCTATGGCTGACGCTTC
TTGCAATTTTTACACTCTTATTTCGGACTCTCTCGGACATCATCCTGATCATCATCACTTATGTGGCCGGTAAGAGAGTA
TTCCAGGAGGTCATGGTGCGTGTCAGCACAGCGCCGTTTCGCTTCTTCGATATCACCCCTGTGGGCAGGCTGATGAACCG
GGTCACGTCGGATATTGGCACCATCGACGGAGCAGTCGCGCAGCAAATCCACCGCTGTGCTTGGTTCATGCTCAACTGGC
TCACGTCCATCTTGGTAATTGCAACGGCCACGCCAACGTTTCTGGCCATGGCCGTCTTTATGACCGTTGCTTTCGTCCTG
GTCTTCATTCGGTTCTTGCCGACATCCCAGTCGCTGCGTCGTCTGGAAATGGTCTCGCTTTCGCCTCTCATGTCCAACTT
CGGGACGCTGCTGGAAGGTCTCACAACCGTTCGTGCGTTCAGGGCACAGCCGGACTTCCAAGAGCGCATCATCTCCACGA
CCGACGCCTTCCAACGTATGGATCATTTCTACTGGTCTCTCCAGGCGTGGCTGCAGTGGCGCTTTAACAGTATGACCGCG
TTGTCCACGTTTGCGCTGACAATAACGGCCCTGGCGACTGGCCTGTCGAGTGGCCTCGTGGCTTTTGTGCTGACAGCTGC
GGCCAATTTTGTCAACTCAACTCAAGTGCTGTGCCGCCGTTACGGTGAGCTTCAGATGCAGTTTGTCTCAGTTGAGCGGG
TCATTGAGTTGCTCGACCTGGACCAGGAGCCGATTGGCGACATTGACCCTCCGGCAGCTTGGCCCACGACAAACGACGAC
ATTGTGTTTGATGATGTGACGGTACGTTATGCACCGCACTTGGAACCCAGTCTTCGCAACATCACGATGCGCATCCCTGC
AGGCTCGACCGTTGCGGTTACAGGACGCACGGGATCGGGCAAGAGCACGCTTGCGCTGGCATTGCTCGGCACAGTGTTGC
CAGATAACAATGAAGCGACGCAGGGAAGCATTTACATTGGGGGAATGGATGTAGCTAAAGTGAACAAGCATGCGCTACGG
CAGCGCATCAGCTTTGTGGCACAGGACCCGGTGCTCTTCCCTGGCACGCTCCGAGAAAACCTTGATCCTATCGGGCATCA
CACGGATGAGGAGTGCATTGCCGTCCTGGCAAAGGTGCTCGGCGACGCGACTGGCGAATTTAAACTGGACAGCCGTATCG
ACGGCGGTGGCAAGAACATGAGCCAGGGCCAACGGCAGCTCGTTGGGCTCGGCCGGGCGGTACTTCGCCGGAGTCCGATT
GTGATCCTGGACGAGGTGCGTGGCTTTGCGTGCCATTAATCTCTTTTTGTGACCTGATGTCTAATGATTAGTAAAGGCTA
CCGCATCGATCGACAAAGCCACCGCCTTCCGGATACAGGAAGTTCTCCGAGAGGAGCTGAAGCACAGCACTGTCATCACG
ATTGCTCATCGTTTGGAAGCTGTGCGCGATGCCGACTTTTCGGTCATCCTCGAGAATGGACGCGTTGTGCTCGCAGCTCC
CGTGACCGAATTGTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62