GenePrediction:GLEAN_5846 Details

Name: GLEAN_5846
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:603971..603020 (- strand)
Length: 952
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:603971..603750 (- strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_173:603688..603425 (- strand)
Length: 264
Type: CDS
Source: GLEAN
Position: GCSC_173:603358..603020 (- strand)
Length: 339
>GLEAN_5846 class=GenePrediction position=GCSC_173:603971..603020 (- strand)
ATGGCGCGCTTCGGAAACTGTCACTGTGGCGGCTACCGTTTCGAGCTGTTGCGCGCTGAGAGCACGGAGGCCGAGGGTGA
TGAAAAGCAGGCTGTTCCGTGCAGCTGTGCGGCCTGTACGAAGCTGGGAGCCCAGTGGCAAGCCGTGGAAGTTGAGGATG
TCCGAGTGATCCATGATGAGGGAAAGATGATGGAGCATCGGTCCCCAAACATGCTGCACAAGGTAGGATGATCCGAACTG
TTTGTGTCCAGGCTGACTTCCGAGCTGACAGGATGCAAACCAGTTCTGTTCCGTCTGTGGCACGACCTTGTTGGGAAGCC
ATCCAGAGGGACAGAGTCCGTGGCGGCAGCAGACGTTGGTCAACTTGCGTGCGCTGCAAGGCTTCAATCCGTTTGCTCTT
GAGCGCGACACCTCCGTCTCCCCTGCACAGGCCCAGACGACCTGGCCGTCTACGGGCTCCTGTCTCTGCGGAAAGGTGGA
CATCACGCTGCTGGAACCGCTGGAGACCATGTCAATGAAGGAGGACAACTGCAGCATATGCACGAGGGTGAGATCTTCCT
ATTTTCCCCGCCATTTTTACTTCCGTCTTTCCTTTCTTTTCTTACGACGACAGAATGCCTGGGTCGGTGCCTATCCATCC
AAGGCGCAGGTATCTCTACACGGCACCGAACATACGCAGGACTACCGGTTTGGCCGGCGTTTCATGGGCCATCCGTTCTG
TCAGACCTGCGGCGTCCACGTGTACATGAATGTCTACGGCCCGCCGCAGCACGTTCTCGACCGGCTTCCAGAGGAGAGAA
AGGCATTGGTGCGCAGAAATCTGGACATTGCGCCCGTAAACATCCGAGTGTTGGATGTTCACGGCAGCCCGTCTGGGCTG
GACATTTCCAGTCTGCCGGTGCAGCGGACCGACGAAGGCCAGGATGGATACGAAATCGATGTGTTGAGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62