GenePrediction:GLEAN_5847 Details

Name: GLEAN_5847
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:600703..599370 (- strand)
Length: 1334
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:600703..599785 (- strand)
Length: 919
Type: CDS
Source: GLEAN
Position: GCSC_173:599734..599370 (- strand)
Length: 365
>GLEAN_5847 class=GenePrediction position=GCSC_173:600703..599370 (- strand)
ATGACAGGGACCAGCTTCCTCCACCGCGCTGGCCTGTGGCTGCAGCCACGCATCCCCCGGAAGCTGCACGGCCTGCCGCT
GCCGGCGCTGGCCCTGATCAGCCTTCTGGTGGTCGTCAACGTGCTCGTGTGGGCGGTCGTGGCGGTCGTGCTGCGCTTCT
ACCCGCGGCTGATGGGCTCGGCCGTGCTGGCCTACACGCTGGGGCTGCGGCACGCGCTCGATGCCGACCACATCAGCGCC
ATCGACCTGATGACGCGGCGGTTGATCGCTGCCGGCCAGCGGCCGGTCGCCGTCGGCACCTTCTTTAGCCTGGGCCACTC
GACCATTGTCGTGATCACCTGTGTTGTCGTGGCCGCTACCTCGGGCGCGCTGCGAGACCGCTTCCACAGCTTCGAACGTG
TCGGTAACATCATCGGCACCAGCGTCTCGGCCGCCGTGCTACTCATCCTCTGCGTCGGCAACGCCTGGGTGCTCTGGCGG
CTCGTGCGAGGCCTGCGCGAGGAGCTGCGCACGAGAGGTGCCGGCCGTGTCCGCAGCCCAGAGAATGCCGCTCTGGCCAG
TGCCGGCAGTGGTGCTGATGAGGGCGACGCCGACCGGGTGGCCACCCACGATATCGAGGCCGTCGTTGCAACCACCGCTG
GGACGGACGCAAGGCCAAACAGTCGGGTCGGAACAGCTGCTGCCACTTCCACTCCCTCGGCCGCTCATCTCCATCTGGAG
GGCGGCGGCCTGCTGGTCCGCCTCTTTCGCCGGCTGTTCGTCCTCATCGATCGGCCCTGGAAGATGTATCCGCTCGGCCT
TCTCTTCGGCCTCGGCTTCGACACAAGCTCAGAGGTCGCCCTGCTGGGCATCGCCAGTCTGCAGGGCAGTAACGGCACGA
GCATGTGGCTGATCCTCATCCTCCCCATGTTATTCACTGGTAAGCATCTCCTCTGTTATGGGACTATTCTCCGATTCTGA
TCCTAGCAGCCGGCATGTGTCTTGTCGACTCGAGCGACGGCGCTCTGATGATGACCCTCTACACGTCCAAGGTCTTTTCT
AGAGACACCGTGGCCATTCTGTACTACTCTGTTGTGCTCACGGGGATCACCATCGTAGTAGCCGCTTTTATCGGCGTGGT
CCAGGTGCTCACCCTCGTCGACAACGTGGCAAGTCCCGAGGGCCGCTTTTGGGATGGTGTCGGCGTCATAGGTGACAACT
TTGACGTAATAGGCGGAAGCATCTGCGGTCTCTTTCTAATTGTCGGCATCGGATCAGTCCTCGTGTACAAGCCCTGGCGG
CAATACTTAGACAGAAGGACTACAGCATGCCACAATACTGTCAGTTCGGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62