GenePrediction:GLEAN_5848 Details

Name: GLEAN_5848
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:588591..584387 (- strand)
Length: 4205
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:588591..587592 (- strand)
Length: 1000
Type: CDS
Source: GLEAN
Position: GCSC_173:587530..586727 (- strand)
Length: 804
Type: CDS
Source: GLEAN
Position: GCSC_173:586659..584387 (- strand)
Length: 2273
>GLEAN_5848 class=GenePrediction position=GCSC_173:588591..584387 (- strand)
ATGTCTCGACCAAATCCGACCACGCCCTCCAAGGGCAAGGGTAAGGCTGGGGTAACTGTTGAACGTGGCCGCGAAATTGC
CACTGAGCTGAACCGGACCTACAACTTGGGCATGTCTCTGCCAGCTGAATCAATGTCACCGGTTGCGAAGGAGAAACGGG
CCGAGCAAGATGTCGACTTCCGGCGACATAATAACATCGTAAACAACTTGCGCATCCTTCACTTCAAAGACAAGGAACGC
CTCAAGGCGACGCTTGACGAATTTGATGTCAAGGCCCGCGAACAGAGCAACCACTGGACTCGGAAACTGCGCGCCAGGCC
AAATGGCCCACCACGGGCCTATGCAGCTGAGGACCAGGTCATGCTGCAGGAGCTTCTTGTCGACGTGCTTACCACGGCAA
CGGATTCTGTCCGTGAGAATCTGACGCAGGCCACCCGTGTAGGCCACGATGTCGCTGCAGCAGGTACGGCAACACAGGCG
AGTGTCTTTGACTTGGACTCCTCTGCCAGTCCTGCTGCCGACATAGACCGAGTGCCAGTCTTCCCGATAGCTAGTAGCAC
TTCATCGCAGCCAGCGTCCGGGAATTCTGGAGCACAAGCTTTGGAAAAGAGCTTCTGGAATGAGCAGAACCGTACAAAGA
GCACCGGAACAGACTCCAGCTCAAGATCCACGGCCATGTTTTCGGCTCTGGATTCCCTCGAGCCGTTTGAGAGCCAGGCC
TCCGCGTCTGCGCATACCGAAGATGCCAAGTACTTTGGGAGTGGACTTCCACGCCCGCCGTCTCAAGAGTCGTTTGCGAT
ATCAGACACCAGCCTCGATGCTCTCGAAGATTCTTTCAATCTGTACGGCGACGTAGCAAGGGTCGGCTCAGCAGAGGGCT
CGGAACAGTCCAGCATTCCTGAAATGGCCGATCTTCAGCTCTCTGAGTACGACACCGGCAATACAACAGAACTGCCATCG
TATGTGCCTGGGCTCTGGGACCGTTTGACTTCCGTGTTTTGTTAGTCCACCGCGTCCGAACATAATTTCTTTTTGGTTAG
TCCGGTCTGACCTGATAGCAGCTTCCACGCCTGAATGGCTGCAAGACGCCCCGTTCCCCTTGATCTGGGAGATTGTGCGG
ATTTCTCTGTTCTGTTCTGTGAGCCTCGGCGACATGTCGTCAGAGTACTCGACCCTGTGGCATAACCAGGACGTATTTCG
AAAGGCTCTCTCCAGTCACCCTAGCTTTGTGGGAAAGCCACTTCCAGAACCATCAAGCCAGCTCGCGTGGGATGTTGCCT
TCGACCAACGGACTTCCCGCGGGAAGACGGAGCTGTCCCCCATCTTCACCGCCACAATGGATTTTAACCTTGGTCACACC
GGCCCACTTTACCTGTTGAAGCTTCGTCCGATCACGCTCGACTATCCTCATCGTCTGTCGCGCCACTTTGGAGCAGATCG
GTTTATTGAGATTCATTTTCCGTCGCACCATTCCGGATTGCGCGCCGTGCCGAAAGTACTTCGAAAGAATGAGGATGCGG
TTCAAGAAGTCAACCAATGGTTGACACTACAGCGTCACCGTTTTGTTGGTCGAAATTGGGTGGCGTTCTACATCAAGGAT
GCAGGCTTCAAGAAGCCAGCCCTGTCTGATGAACGAGGGCTGGGGGAAAAAGTGCCGTCTGTCCTGCTGAAGAAGGCGTA
TTTGTTTGCGGAGGATGGATTTGGCCTTTTTCCAGATGGGATTGTGGGGCGCGTTGAAGACAGTGAATGGAGGTTCGGGC
ATGAACTTCAAGTTCATGATATGTTGGAGTGGCTGCTGCAGTACAACAGGTTTCATGAAAACCGGACACAGCCATACCTG
AAGCTATTTTCTCGCATAGCTCTCGGTAAGTGCCAAGGCGGCGGGTGCCTAAAGAAAGGGGAAAGGGAACACTTCCATCT
AATGATGTCCAGGCCTAAGCCGGACCATCCCTACGGTCGTGTTTGAGCCGGAGCAGATGCGCCACCATGCGTCGGATATC
ACAGCACCGGCGACGGGAAAGGTGATGAACGACGGCATTGGGCGTATGTCGCTGAGTGTAGCACGCAAAGTGCGATTCGA
GCTCGGCCTCAGTGATCTTCCGGCAGCTGTGCAAGGCCGTCTGGGATGTGCGAAGGGAATGTGGATTCTGGATCCAACTG
ATACGGGAGGCGAAGACTGGATAGAGACGTACCCATCTCAACGCAAATGGAAGTGTGATTTTGTGGATCCGGACCACCGA
ACACTCGAAGTTCGCAATTACGCATCGGCGGTGCGATCAGCCGGGCTGAACCAGCAGCTTCTGCCGGTTCTGGAAGACCG
GGCGATTGACAAGTCGCGGATGCGCACTGTGATTGGGGACATATTGAGGGGCAATCTGTACCGAGACCTTGCGACGCAGA
GAACAGCACTGGAACACCCGCTGCTGTTTTCAGCATGGGTGCAGGAGAACTCCCGATCGCGAGATGAACGATCAGCTCAC
TGCCAAGTGCGTTTTCTGGGCGGGCTGCCGGACTCGGACTCGGAGGTGGTCCAGTTTCTCCTCAGCGGGGGATTTGATCC
ACGCGTGCAGAAGATGATATGGGACGTGGCGTACAAGATCCAGAAGGCCAAGTGCGAGAAGCTGAAGGAGAAGCTCAACG
TGCGGGTGGGGAGAACGGCATATCTCCACATGGTGGTGGACTTTCTCGGCGTTCTCGAGGAAGGAGAGGTGCAGGTGTGT
TTTTCGTCCAAGTTCCAGGTGGACGCGGACAGCGAGCCGGACGAACGAGGAGACGACGGGTCCTTTTCAGATTCGCTCCT
GGTAGGCACAGACGTGCTGGTGGCACGGTCGCCAGCTCATTTTGCGAGTGACGTACAGAGAGTGCGGGCGGTGTTCCGGA
AAGAGCTGTGCGTGCTCAAGGACGTGGTGATATTCTCGAGAAAAGGCGACAGCCCGTTGGCGGACAAGCTGTCGGGAGGC
GACTACGACGGCGACATGGCATGGGTGTGCTGGGACGGGCGGATCGTGGAGAACTTTTCCAACGCTCGAGAGCCGGAGAA
ATACGACCTCGTGGCGATGGGCTACATGCAGAAGAACAGAACGACATTGTCGGAACTGTCGGCAGAGACGGGGACGGGAG
CAGGAGGCAAGATCGGGGCGGATGAGGTGGAAGAGATGATGGAGCGGAGCTTCCGGTTCAATATGAAAGAAAACTTTCTT
GGACGGATGACGACATACAAGGAGAATCTCTGCTACTGGCGGGGGACGATTTCGGACGAAACGGGGGTGATCCTCAGCAC
ACTGTTGGGCGAGCTTGTGGACCAAGCCAAGCAGGGAACGGAATTTGACGAAAAGGACTTTGACCGGCTACGAAGAGAGC
GGCTACGAGAATGCAAAGAAAAAGGAGCACTGGCACAGTGGCTCGACAAGCCGCTATACAAAGAAAATGGGTGGCCAATG
GGGAAGTCGGTGAGAGAAGTCAACTTGATTGACCACCTGAAGTTCTTTGTGGCCAAGCCGATGATCGAGCAGGAGCTCAG
GGCGCTGGACAAGTTCGGCGAGTCGGGGAACGACGGCAACGGGTCTATGTACTGGGACGAGGATCTGGCGCGGCCAGCAA
AGGAGTTTGAGACTCTGGCACAGACATCAGGCACGTGCCGGGCGATTCTGGACGGGCTGAAGAGCGACATCGACGAGGTG
CGAGAGGCATGGGTTAATGGGGTGAGCAAATGGAAGAGCAGCAAGACGAAGAGCATGACGACGACAGAGGATATGGGGTA
CCGACAGCAGGTGCTGGAAGTGTACCAGCAATGGTGCAACATTGGCGTGCGGCTGCCGAAGAGGAGGGGGGGTGCAGGGG
CTGCGGACGAGGAGGTGATCCGGGCGATGCTGCAGGAGGACTATCTGACAGACGGCGAGCACAGCCGATGGGCAATGCTG
CGGGCAAGCCAGGCCTTTCGCACCTTCCGCGGACATGGGTCGAAGTTTGTGTGGCAGATGGCAGGACGACAGCTGCAGGC
GATCAAGGCAACGATGGCATATGGAGGCGGCAGCAGTGGTGGAGGAGGCGACGGGACGCGATGCAGCAACGTGATGATGA
CACCTCTGCAATATGCGGCGACACGGTCAGACGGAAAGACAATTCGGCAGATGGTGGCACGGTTACGGGGAATGGAGGAG
GATGCGATGGAGTTTCGATGCGACTCGTTTGAGGATGATGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62