GenePrediction:GLEAN_584 Details

Name: GLEAN_584
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:738039..738880 (+ strand)
Length: 842
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:738039..738180 (+ strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_97:738270..738880 (+ strand)
Length: 611
>GLEAN_584 class=GenePrediction position=GCSC_97:738039..738880 (+ strand)
ATGTCAGCTACACCGGAGACATCGGCCGGCTTGCCCATCCCGGACGAGCCCATCTCCAGAACTGAATCCGCACCGCTGCT
GGGCGACCCGGGCGACGTGCTTCAGCGATCGGGCGAAAGTCTTGTCCCAAATCTGTACACAGGTGTGTTTTGGTGTTCTG
GCTTCGTTTCTGCTTCTGCTTCTTCTGCTTCTTCTGCTTCTTCTGCTTCAACTGTGTATTGTTCTCCCTAGGAACCGCCT
GGCTGGCTCAGGCCGGCATCCTGCTGCTGGTCGCTCTCGTCTGGGCCGCCGTCTTCCGTCATCCACTCCTGCCACTCTTC
TCGCCGCACCCGCTCCTGCAGTCGCTCGGCATCTTCGTCCTCGTCCAGGCCATCCTCGTGCTGCAGCCCACGGCCGCGCC
CACCGACAAGGTGCGCGGCGCCCGCGTCCACGGCGCCCTCCAGCTGCTGTCGCTCGTCCTCTTCGCCGCCGGCATCAGCC
TCATCGAGGCCAACAAGATCCGCTCGCACGGCGTCCACCTGCACTCGGCGCACGGCGTCCTCGGCGTGATCACGGCCGTC
GTCCTGCTGGGCCAGTATGTCTTTGGCTTCCTGATCTGGGCCGCGCCCGTGGGCCTCTTTGGCCGCGTCGATCGCGCCAA
GGCGCTGTACAAGCAGCACCGCTGGACCGGCTACGCCGTGCTGCTGCCACTGCTGCTGGCCACGGCGCTCACGGCCACGG
CCACAGACTACAACGTCAACGTGCTCGACATCCGCACCTGGGCCGTGCTGGTGGCGGCCGTGCTGATCGTCGTCGGCGTG
TACCCGCGCATCCACGGCCGCAAGCTGGGCCTCTGGAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62