GenePrediction:GLEAN_5851 Details

Name: GLEAN_5851
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:569209..566858 (- strand)
Length: 2352
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:569209..569096 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_173:569017..567098 (- strand)
Length: 1920
Type: CDS
Source: GLEAN
Position: GCSC_173:567028..566858 (- strand)
Length: 171
>GLEAN_5851 class=GenePrediction position=GCSC_173:569209..566858 (- strand)
ATGTCGATCAAAAACGAGGCTACGAAGGAGGAGCCTCTGAGCCCCTGGCTCTCGTATATTAATGTCGACGACAATGACAT
TTTCAGCTACAGCAATGACGCCGATCTCGGTGTTGTGAGTTTTTCCTCTTCCCTAGACTATATACATGCGTGCTAGAAAG
CAGGATAGAAGCTGACGAAGCCCGTCGACTAGAAGTCAGACGATGATTGGGGAAGCGACCATTCAGAGATGCTTGAACCC
GAGAAGCCGCACTGGCTCAAAACTGAGCCCACTGTGGCTCCTGATATTGTGACTGGGCCGACACCCACGAAAGAAGACCT
GGCAAGCGAGGCTCATGCAGACTCCAAGGCGGACTACCACGTCGAGGCCAAGCTGGAGGATGTCGTCCCCGTCAAGTCGG
ATGTGGATAAGCAAGAGCGAGTGACTCTCAGGGACAATGGCAAGAACAAGGAACTCTGGTCAGTCAACGAGGACCTTGGG
AACCTGTGTCTTGGGGATGTAGTGCTGAAGGAGGAGTCTTCCTCCAGCATCGGTTCGGCTTCGCTTGACAAAGTCTTCGA
TTCTGTCCTATCTGAACGGTACAATGACCACAGCTGGACGGATCCCAGGGTGATTCTCAGCGGGTCGTGCAGTACATCGC
CGCTGTCGGACACTACTCTCGAGTTCGACACTCCGCCGAACTACATCAACAGCGCCTTGCTTAGGCGGTGCGGCCTTGCG
GTTACGAAAGAAGAGCTAATTGCGAAAGAGGTGCTGATCGCTAAAGAAAATTTGATTGCCAAGGAGAAGCGAATGGCGAA
GGAGAAGCGGATTGCCCAGGAGGAGATGATTGCGAAGAGGGAGCACAACGAAGCTGTCGGAAGTGAACTTCCCACTTTCT
TCCCGCACGGCTATGAGACCATAGACAGCATGCAGCAGACAGAGAGGCTCAATGCCCTCATTCACGCAGAGGCGTGCAGA
ACTGAGGCGATGTACCATATGCAGGGCATCTCGCCGATGCTGCTTCAGGTCCAGCAGCAGAGCCCGTATCTTTGGGATGC
CACCCCGGTGATGCCGACAACGGCGGAAGAGTTGGAGTATTGGGCGGCTCAGACGGCGAGCTACTGTGACCCGATGGCGT
CGCAGCAGGCGCAGTTTGCGCCTCCTTTCAATACTGAGGATATGCGCGCGTTCTCGCCGGTGATGCCGGAGAGCGGCAAC
CAGACGGACCTGCCGATGTGTCAGCCGGTGACAGCCTCGCAGCCGCAGATGAAGACTGAAGAACAACCGCATTTGATGTC
GATGGTGCCTTTGATTCCCATGGTGCCAATGGTGCCAACGATGGCAAGGATGCCAACGGTGCCTGTGATGGCCTCCTCCT
TCCAGCCGAGCTACGAGGCCTGGGACAAGGAACCGCTCGACTATCGCATGAATGCCACGCTGGTCTCGTCGACATCGGCC
CCCTGCCCATCCACCAGCCGCACTCAGCTGCCGGGCTTCAAGGGATCCGACTGTGAGAGCAGCGACGACAATGGCGGAAA
CGACAGGAAGGCCAGAAGCACGAGCCAGACGACTGGAGCCAACGGTGCTTCGCCCAGACAAAAAAGTCCTATCTACAAGA
CCCGTCGGGTGACGCGTCGCCAGCAGCAGCAGAAGGCGGGCAGCCTCGAGAAGAACGCCGAGATGGCATCGCGTGCTGGC
GAGTCTTCGTGCCAGCCGTGTGCTGCTGGTCCCTCGTACCAGCACCGCGAGGCCGAGCCGTGGACGACGCTGCTTCCTCT
CCGATCCGCCGTCACTATGGACGACATTGCGGCCGCTGGGCTTGGCCATCGGGACTGTCCTACCGGCCTCCAGCAGCAGA
CACAGTCGCTTGCGAGCCACCAGACGGCGCTGTCGCCATCGGCCGAGTCGCTGCTCTCGGAGGCAAGCCAGATGGCCCTG
CAGAGCCAGATGGAGGATCGCCTGCGCAAGGACAACTTTCTGATCGAGCAGAAGCGTGCTGGCCTCACGTACAAGCAGAT
CCGCCGCCTGGGCGGCTTCCAAGAGGCCGAGTCGACGCTGCGCGGACGCCACCGCACGCTGACTAAGCCGAAGGAGGAAA
GAGTCCGCAAGCCGGCCTGGACAGAGATGGATGTGCGTATGATGCTCTGTTCTGGATGTGCCGACCGGTGTGCCCGCCTG
GGACTATACTGACGGCGACAGGACCATCTGCTCCGCCGGGCCGTGCGTAAGCTCAGCCGTGGTCGCGACAGCGCAAAGGC
CAAGATCTCGTGGAAGGCTGTGGCGGACTATATTTACGACTGTGGTGGTTCGTATCACTTTGGTAACACAACCTGCCGCA
AGCGGTGGGACTCTCTGGTGGCGCACAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62