GenePrediction:GLEAN_5852 Details

Name: GLEAN_5852
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:552019..550283 (- strand)
Length: 1737
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:552019..551946 (- strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_173:551887..551272 (- strand)
Length: 616
Type: CDS
Source: GLEAN
Position: GCSC_173:551170..550283 (- strand)
Length: 888
>GLEAN_5852 class=GenePrediction position=GCSC_173:552019..550283 (- strand)
ATGCCTTGCGGTAACTCCTTCGCCTCGTCGCTTTCCTGCCTGAACCTGTTTGGTTCAGGAGATGGGAGCCTACGGTAAGA
GAATACGTCGACAGAGGAGCCTGACCCGAGTGTTGAGCTGATTCATGTGCAGGGCCATGTTCAAGAAGAAGACCTTATTC
GCACGCAGCAGAAGATTACGAGCTCGACAGAGCCCGGACACGGAGTGCCTGTTGAGAACGAGAAGCGAAAGCGTGGTTCC
GACAGACGAGAAGCAGGAGTCGCGGGAGCGGTCGTCGGTCTCGTTTGCGGCCTTTTGCGACGACGACGAAAAGGAGGCAG
CAGCAGCAGCGGCAACACCGGTGCGCCAGCAGAGCCGATTCCTGTCGTTGCCGCAGGAGATCCGTGACGAGATCTATGCG
CACGTCTTCCGGTCGACGCGGCTGGCAATGGGTCGACGGATCAGCTGCTCGACAGCCGTTCCTGTTTCGGCGTATGGCCA
CCATGATGGCCACCATCGCCACCACCACCACGAGCACGACCAGGCCGGCGGCCACATCGACATTACGCGCATCCGGCCGG
CGCGCCACGCGCTCGCGCTCTTCCACGTCTGCCGCCAGGTGCACGCGGAGCTGCACATCGACGATGCGTGGTTGGGTCAC
GTGCTTTGGGATTTTGCCGACCTCGCCACGATGCTGGACGTGTTGGGCGGCACCTCGGGTCCGGCGAGCCCGCTGGCCAC
GACGGCTGGCCGCGGACGTGTGCGTCAGGTGCGTGTGCGTGAGGGCGGTCTGGCACGCACGACGCCGCATCGTGGCCGCT
GCGGCTTCCTGGTTGGCGCCCTGATGCGGCTACTGCCCCGGCCCTGCAGCTTGACCGCCTGACCGTGCTGCCGGCGCTCA
GCTGCCGGCTGCACGGCACCGCCTGCTGTTACGGCGCCACTACGGGTGGTGGCAACGGCCGCGTGGCCTCTCATGACGTG
CTGGCCGAGCTGCTGCGCACCGGCCGCGGCTGGCGCGAACTCTGCTACGTCCACCACGACGTCACTATGCTGGCGGCCGA
CCGACGACGAGGCACCACCAGCCATGCTGCCGGCCATCGTCGACCTCCCGCACACGGTCGCCACCGGACCGACCCCGGCC
ACCGCGGCCACGCTCTCGAGGCCATGATGGTCAGCATGGGCTTCTGGGATGACAACGAGGCGGACGACGACGTCCTCCTC
GACCGCTCCGCCGCTCCGGCCCGCCATCACAGCCCCTCGTCTACCCCCCGGTCTCCCCGTCCCAGCAGCATCTTCACGGC
CTACGCTGAGTCGAAAAAGTTCCGCCTGCCCGGCTGGAGAGCCTTGCTGGCTGCCCGTGACGACAACGCAGACACGACGG
CCGACACCGATTCCGCTGACTCGCCGCTTCCTACCTCCGTCGACGTCTACAACATGCGCGCCGGCCAGACCTTGCGCCCA
ATCCGCACCCTCGCTGACGTCTACACGATGCGGCTGCGCAGCGACGATTTTGTCGTGGTCGCCCGTCGCGAGGACAACCA
TGCCGCCACCACCGAAGACACGGCCTATCCCTACGTCGACGGCGACCCGCGCACGCTTGGCTATGGCACCACCTGGGAGG
AGCTGCGGTCCTTCCTCTTCCCTTGGGACTACATCCCCGAGACCCGGCACCGGTACGATCGCTACACCCACAGGGATGAG
TACGTCGTCGGCCCGCTGCGACATCCCAACGGCGAGTTTGGGCCCAGGCGGAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62