GenePrediction:GLEAN_5854 Details

Name: GLEAN_5854
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:548568..547404 (- strand)
Length: 1165
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:548568..548162 (- strand)
Length: 407
Type: CDS
Source: GLEAN
Position: GCSC_173:548102..547619 (- strand)
Length: 484
Type: CDS
Source: GLEAN
Position: GCSC_173:547556..547404 (- strand)
Length: 153
>GLEAN_5854 class=GenePrediction position=GCSC_173:548568..547404 (- strand)
ATGCTTCTCCGCTCACAAATGCTGCTGGCAGCAGCCGCGGCCCTGCTGTCAGCACTGCCTCTCGTGGCCGGCGCGCCTGA
TGCGCCGGCGGCCTCGCCGACCAAGACGACGTCCAAGACGGCGACCAGCACGACGATGACGCTGCCGTGCACGGCGTCGT
CGACGAGCGGCGCGTTCTATGACCTGCGGCCGGACATTGCGGTGGCGCTGGCGCCGGGCGGCAAGGCCAAGACGGGCGTG
CAGACGACCGACTACGCCGCCCGTGGCTACGACTACGGCGCCAACTTTACGCTCAACATCTGTGCCCCGGTCGTCGAGCC
TGTCTCGGGCGTCATGGGCGTGGACAAGAACCTGTGGGCGAACGTGAGCGCGTACTACAAGGTCAAGGACGAGATCTTTT
CTCTCGGGTGCGTTTTGTTTCTCGGGTCTTCCCTCTTCCTTCTTCGCCCTTGCTAATACCATCCAGACAACAGTCGACCT
TGCTGACGTCGCGTGGCCGCGAGCTCGTCCTCCAGTACTCGGGCGGATCGCCGTGCCCCGACCTCAGCAACAAGTCCGGC
AAGGGCCACGGCGCCGAGCGGATGCGACGCGGCAGCACCGGCAGCACCGGCAGCACCGGCAGCACATCGACAACCCGCCG
CAAGTCGGCCACGTTTGCCTTCCTCTGCGACCGCGACCCGGTCGACAACCTGGCACACATCTCATACGTCGGCGCGGTGG
ACGAGTGCGCGTACTTCTTCAAGATCCGGTCGCAGCACGCGTGCGCGGGCGCGGAGCCGCACAAGCCCGGTAGCGTCGGT
CCCGGCGGCGTCTTTGCCATCATCTTGGGTGTCGCCCTGATGGTCTACTTCATCGGTGGCGTCGTCTACCAGCGGACGGT
GGCCCATGCGCGTGGCGCCCGCCAGCTGCCCAACTATGCTCTCTGGGTCGGCATCTGGACCTTCTTCCGGGTGGGTCTCG
TCCATCTCCTCTTTTTGCCGCGGGCTGCCCTGTCGGTGCTAATGCAGGCCAGGACCTCTTTCTCATCCTGACGTCGTCGT
GCCTGCGCCTGCTGCCCTCCCGTCAGGGCTATCGGACGCTCTCGACCTCGCCCAGCGGCCGCAGCCGCAGCCGGGAGGAC
GAGAACCGGCTGATCGACCAGCTAGACGAGGAGTGGGACGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62