GenePrediction:GLEAN_5857 Details

Name: GLEAN_5857
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:529624..528223 (- strand)
Length: 1402
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:529624..529317 (- strand)
Length: 308
Type: CDS
Source: GLEAN
Position: GCSC_173:529261..528223 (- strand)
Length: 1039
>GLEAN_5857 class=GenePrediction position=GCSC_173:529624..528223 (- strand)
ATGGCCGCACCAGAGAGCACGTCGAGGCTGTTCCGGGCCATCATTGCTGGCGGCAGCATCGTCGGTCTGACCATGGCGCT
GGCTCTGGACCGGGCTGATATTGACTATGTGCTGCTGGAGACGGGTGAGGTGGCGCCGGATCTGGGGGCCTCGGTCTCGA
TGCATGCGCACACGCAGCGCGTCATGGAGCAGCTGGCCGTCTGGCCCGAGATCGACGCCGCCGTCGTCCCGGTGACGGAC
CGGGAGCACTATGACGAGCACGGCTGGTTGTTTGAGAAGTCGGCCATCCTGCAGGAGATCTCCAAGATGTGCGTACTTTG
CTGTCATCGCGTGTCTCGTCACCCCATCTGACCAGCGGCCCAGGTGCCTCGGCCGACAGACGTCCTTCATGGCGCGCCGC
TTCTGGCTGCAATGTCTGTACAATCAGATTCGCGACAAGAACAAGGTGCGGGCCCACACCGGCCTGGTGTCCTTTGTCGA
GACGGCCGACGACGTGACGGTGACGACGACCGGTGGCGAGATCATCACGGGCGATGTGCTGATCGGTGCCGACGGCATCC
ACAGCACCGTGCGGCAACAGCTAGCCGACGAGGCCGCCGCCGCCGGCAAAGAGGCTGCAGCGACTGCGATGCGTTCTGGC
TTTGTCAGCAAGTACCAGTGCATCTTTGCGACAGCGAAAAACGACGAGCCTCAGCAGTTCCTCCTCCCCGGCATGGTCCA
CAACGTCTACTACCGCGGCTTCTCGGGCGTCATCTCGGCCGGCGTCCCTGGCTTCGCCTTCTGGTTTCTCTTCGTCAAGA
GCGATCAGGCCAGCCGGACGCCCGACACGCCGCGCTTCAGTGATGCCGACGTCGAAGCCGTCATCGACCGCTACGGCCAC
CACGCCGTCGGGCCTGGCTACACCTTCCGCGACCTCTGGCAGGCTACCACCAAGGCCGCCATGCTGCCGCTCGAGGAGGG
TGTGCTCGCCACCGCCTGGCGCTCGCCCGGCGGCCGCGTCGTCCTCGCCGGCGATGCCGTCCACAAGGCCACCATCAACC
CTGGACTCGGTGCCAATCTTGGCGTCGAGGGCGTCGTCCACCTCGCCAACTTGCTCGTGCCGCTCGTCCGTCGTGTCGCT
GTCGAGCCGGACGACCGCAACTGCCACACCCGACCGACCCGGCTGCAGCTCGCCGACGTCTTTTCTGCGTACGAAAAGCT
GCAACGGCCACACGCCGACCTTGTCGTCTCCATGTCCAGCTACCTGACCCGATTCGAGGCCATGGAGACCTGGTGGCTGC
GCCTTCTTCGCCGCCTGTCGCCGTGGATCAGCGATCGGACAAAGGCCAGCAAGTTCGCCGGCTATGTTCGCGAGGGACCC
TGGCTCAGCTACCTGCCCAACCCAGACGACGAGCGCAGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62