GenePrediction:GLEAN_5859 Details

Name: GLEAN_5859
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:511979..510741 (- strand)
Length: 1239
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:511979..511472 (- strand)
Length: 508
Type: CDS
Source: GLEAN
Position: GCSC_173:511403..511228 (- strand)
Length: 176
Type: CDS
Source: GLEAN
Position: GCSC_173:511159..511135 (- strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_173:511060..510741 (- strand)
Length: 320
>GLEAN_5859 class=GenePrediction position=GCSC_173:511979..510741 (- strand)
ATGGCTCTGCGTACAGTGGCACGCTGGTACAAGATTCGCACGTTTCCCTCGGAATTCGAGGACCTGGCCATGTATCTTGC
GCTGGTCTCGTTCATAAACACGGTTGCGCTATACCTGACCACGATTCCGACATACTTCAACGTCGAGGCCATCGTGGCCG
GAAAAATGGCAATCTACGCTTCGCTTGAAAAAGACCTGGTAGTAATGCTCAAGGAGTTCTTCGTCGTTCAGTTCTTCTTC
TGGCTCACTTTGTGGGCCGTGAAATGGAGCTTGCTATTCCTGTTCAGGATGCTCACAGACAGGCTGCCGATTTACAATCG
GGTTTGGTGGGTCGTTATTGTTTTCTCGGTCCTGACCTTTATTGGGTGTGCCGTCAGCAATTTTACCGCTTGCTCTTCCA
TGCATGCGTGGTTCGATGCCCTGGCATGCCAGACTCCGAGGGATGCGCGGGCAAAAGCCATCAGCTTGTGGTTCAGCCTG
GGGGCTGATCTAGCGACAGACCTCTTGAGTAAGTTGCCCGTCGTAATGGATGGAAGCGGAAACCCCGGTTGGCCAATGGC
ATGCTAACTGTTCCAGTCATGCTGATTCCTGTCCGTGTTCTCTGGACGCTCAAGATCTCTACGGTGGAGAAGTTCAGTGC
TGCCTTTGTGTTCGGTGTGGGCATCCTGACCATGATTACTGCCATCATCCGCAGTGTGTCCTTGGTGTCAAGCACAAGTG
CAGGCCAAGTCAGCACGACGTGGCTCATGATGGTGCGTACTCTCATAGACCTTTGCCGAATCAAAAGCAAGGATCAGTGA
TAGCTGACTATCTACTCTAGTGGGCTGCAATCGAAGGAGCTGTGGGTAAGTGTGCTGCTATAGTTGCCGTTCTATACTCT
TGACAGACGATGCAACATTAGGAACTGACCAAATCCCAGCAATTGTCGTCGGGTGTCTCCCATCATTTGCCATAATCATC
AAAGGCCGCGTCGCCGCTTCTCGGGCTCACAACGACGGAAGCTCCCCTACCCCTAGAAACATGACCTTCTTCTCGGCACG
CTCGAGGCCCCGTTCTCCTTTTAGCAGCACGCAGCCGTCCGATTGGCAAACGAACGATACGGCGAGCGACAAAGGCCTGG
TTGGTGGCCGGATCGTCGTGACGCAACACAGGAATCATTCTTGGCATACCATTGAAGAACAGCAACGTTGGGGGGATGGA
ATCCGCGAAGCACACGAGTTACAGACGCTTCCGGTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62