GenePrediction:GLEAN_585 Details

Name: GLEAN_585
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:740415..746842 (+ strand)
Length: 6428
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:740415..746522 (+ strand)
Length: 6108
Type: CDS
Source: GLEAN
Position: GCSC_97:746618..746842 (+ strand)
Length: 225
>GLEAN_585 class=GenePrediction position=GCSC_97:740415..746842 (+ strand)
ATGGCCAGCTGGGCTCAGGATGAAGCGCCTCCTTCCCAGAGGCAGGATGAGCGGAGCAGAGGGCGGGCACCTGAAAGCAG
GTGCTCCCACAGTCCAGACAAAAGGGAGCGGCGTGGCAGCGACACCGGCCCCGAGACATCGAGCTGCCCAGCACGCCTAG
ACGGCCGGCATCGCTCACAGAACCGGTCGCAACCGCAGCAGCCGGCAGGAGCTGACTTGCCCTGCTCCAAGCGGCAGCTG
AGCGACTACCGGCTGAAGCTCACGCGAGACATGTCTGCTCGAGTTGGCCACGCACCGCCTCTGGCCGCAGCATCGACGTC
TCCCAAGCATCCGTCGCCCGCCCGGGAGGTGCTGACGCCATCTCCGGTGCTGCCGTCCTCGGAATCCGGATCCGGATCTG
GCAATACCACGACGTCGGCTGGGTCTGTCCAGACCGTGCGTGCTGCCGCCGCTGCGACCAAGGACTTCTCTGCTCCAACG
CCGTCCTATCCGTTTCCTCGAGTGCCATCGGGCGCATCCCAGGTGCCGCCGAATCCTGCGCTCAACGACGTTCCCGAAGA
AGCAAGGCGGCCGAGGTTGCCGGCCAAGAGCGACGAGCCGTTAGCCTACATCCTCTCAGAGAAGCTTCTGCCCACTCCAC
CCACGCCAGCATCAGCGGCAGACTTTGCCCCCAGAAGCGCTGCCGGAGGCTCTGGCACCGCATCTAGCTACCATGGCTAC
AGTCGCCAGCAGGATGTTCACCCAAACCCCGACCTGCCCAGCCCGAGTCTGTACGATCTTGCTCTTGCCCTGTCCTCGGA
ACCGGGCCTCGATGCCTGGTGGACCAACGTGATTCAGGTGACCACAGAGTGGTATAAGGCGGAGCGAGTGGCGCTGGCTG
TCCCGGCAGATGCCACGGACGTTGAAAACATGCCTTGGGGCCAGCGAGCCACGTTCAACGCACACGAGGGAGACGATGAA
TTGAGCCTGGGCTACATCGGTCGGGACAGCAATGCCGTTCTCAGCAACGCAGATGCTACGCCCCTGGACGCCACGTCTCT
GTCGCCAGTTAGCGACCTTGCCTCTCCGCCCTCGGCAATTCCTTTGCGACGGCCTGACCTGACGAGCCGGTACTCCGACA
CTGCTTTCGAACACCACCGGAACCAGAAGCCAGAGGACTTGGCTGGTACAGACCAGCCTTCGCACCCGCCTCTACGTCCC
GCCCTTTCGAGATGGCAAACCTCCGGTCCCGACTCGACGCAGCGCTCCGATGCACCAAAGGCGGACTCGCCGCCCAAGCC
TTATGCCGGCCTCAACCATGCAGCTCTAGAGGAGCACGACGCTGCAGAAGGCACGCTTCGCCTCAATCCTATGCTGGATG
TCCCGAACTGCCTGCCGACCGAGACTCGGGGACGAGTGCTGCCCGTGCTACAGGCGCTAGACTACGAGGCAGATCCACTC
ATAGATCACAACGGTGTCCAGCGAGTGTTGGACCGAGGCCATGTTGTTGCTTTGACGCGATCATACCCGTACCTGAAACG
AGTACGCAACGAGACGGACAGACCGCAGGAGCGAGGGAGCGCAGAGCTTCGGTCTGAGCAGGCGAATAAGCTTCCCGGAC
TGACCCGCAGCTTGAGCTCCGCGACAAGAAAGACGAGCAGGCCGTCCAGCATATACATGAAGCGACTAAATGGGGCAGCA
GGCATCGCGGCCTCGAAGCCGGGAGCGAGCGAAGCGCAGCGGCCGCGGACGCCCATGTACGAAGAATGCGAGCAGCTTCC
CCCATCTCCTTGGGCACAGTCGCCTGCACCGTCACCTGCCGTGCGGCCCGATCCCGACGACAATCCGTTCTTCAAGAGCA
CTACGGTGGACGAGGATTCCTTCAATCCTGCCTCGGCTCCGGAAGACTACAAGGACATGCTGCCACCGCCTACGATTGGG
GTTGAGAACGCGTGGACAGTCCTCCATGTGCCTTTGTTCCATCCGCACCTGTCCAAGCCGAGCCCATCGTCATTCAGGCT
CGACAAGACCAAGATGGAGCGGCGATCGTCTCCGCGCCGCAACCCGAACAGCTCCGAGGACGGGACCGGCTCTGTCACGG
CATTTTCCGCTGCGGTGTCTCCTGAGCGGCCGTCGAGCCAGCCGAAGCAGGTCCCCATTGCGATCCTGTCAATTCTGAGC
CCGATCATCCCCTACCCGTCGAATCTGCGCCACTCGCTCGAGTTTCTGGCCCCCCATCTGGCGACGTCCTTTTCGCTCTG
CCTCCACTACTCCAACCTGGAAGCAGAGGTTTCGGGCCTTCACCGTCGACGGCACGAGCTGGGCGGGTTTGGCGGTATCG
ACGTCAACGGAAATCCTTTCCCGACGTCCACGACGACGACGGACACGCCCTACATGCCGTTGCACGACACGCTCGCACTA
CGATCGATGGCCGGGAGCACAACGAGCTACAGCGATAACTCTATCCCGTCTCGCAGCGCGCTTGGAACGCCGAACGGCAC
ACCTGGCTGGGACTCGACATCTCTGAACATGTTTTTGGACAGGCGCGTCAACGTAGGGAGTGGCACAAGCCCCGGACTGG
CATCTTTGGCGGGAGACGGCTTAACTTTTGGCTTGCGGCCGTCGGCGCTGGGACACTTTAGTCGGCCAGCCACGACGCCG
GGAGGAAGCAGCAGCAGCAGCGCGCCCAGAGCTGCAAAGCTATCAGCTGCACCGGGCGACAAACGTATTCCGGCGTCTGC
TTTTTCCCTGACAGAACAAACATCCGTCACGACAGCCGGTGAAGGCTCTCTGAGCCGGGCGAAGAAACCACCGGCCGCGT
TCTTCTTCGGCCTCGGATCAGACGGTTGCGCGACACTCCCTCCGGACGGAGACAGCAACGACGCCGGGACTGAAGCGGAC
AAGGAACCGGTCAGCCCAGTACCCAGTAACATCGTCGCCGGCCTCCGAGCGTCACTCTCTTCCAGGACCGAGCAGAAGGT
GGCGACGGCAGCGGCGAGCAAAGAAGGGAGCCTGGACGAGTTGGCAAGATCGTCGCTCAGCAACAAGATGTTCGTGCCCA
GTCCGTTTGGCTCTGGAAGCAGCCCCCCCAAACATCGCCATGGCGGTCGCTCGATGCACCGCTACAGCTATAGCTACAGC
CACAGCCAGCTGCACTCTCATGGAGCCGACTTTGCGACAACATTCCCGTCTCTCCCGCCTAGCGCCAGCATCAAGTGTGT
CAGTGCTGTTCCCACTGCGTCTCCAGCCGTGACACCGTCCCTGCTCGGGCCAGGGGTAGCACCGACAAGCCCCGTGGACA
TGCCGCCGCCGTCAGACCGGCTGAAGGGGCTCATCCTGGACTCGCTGCCGGCCCATGTGTTTGTGGCGATGCCACAGACG
GGAGCGATTGTGTGGGTCAACAGTCGGTACCTGGCATACCGAGGACAGACGGTGGAGAGCCTGGCACAAGATCCGTGGGT
GAGCATCCACCCGGACGACCGCGAGGAGTACCTCAAGGCGTGGAGCCACTCGGTGCGGACGGGCGACCAGTTCTCGCGGA
CAGTGCGGATTCGACGATTCGACGGGTCGTACCGCTGGTTCCATGCGCGGGCGGTGGCCTCACGCGACCGTCGCAACAGC
ATCGTGCAGTTTTTGGGATCGTACATGGACATCCACGACCAGCACATTGCGGAGCTCAAGGCGGCGCGGCAGGAGGAGAT
CGAAGTGTCGGAGGCGAAGCACCGGATCCTGGCCAACTTGATCCCGCAGATCGTCTTCACTGCGAACGAGGAGGAGGGGG
TCACGTTTGTCAACGAGCAGTGGCTGTCGTACACGGGACAGAGCTCGCGGGACGCGCTCGGGCTCGGGTTCATGAACTTT
GTCCACCCCGACGACCTGGCCAAGTGCACGTTTATTCCGGTTCCGGCCCACCTTCAACGGCGCCGCCAGCAGCTGCGGCA
TGTGATCGCATCGGGCGGCGCGGGGGGGCGCAAGAGAAGCGATGACAGCAGCAACCCGTCCGGAGAGCGCACGCCGGAGA
CGGGCAATGGCGAGGGCCTGAGCGAGCTCGCGGAGTTGGCGCGACGGGACATTATCATCGTGACGGAGGACGACAACGGG
CGGCCATCATACACGACAGAAGTGCGGGTGCGGTCGAAGACGGGAGACTACCGGTGGCATCTGGTCCGTTGCGTCGAGAC
AGGCACGGAGGATTTTGGCAAGGGCCGCAACTCGTACTTTGGGTCGGCGACGGACATCAACGGCCACAAGCTGCTGGAGA
CCAAGCTGAAGGAGGCGATGGACTCGAAGACGCGCTTCCTCAGCAACATGTCGCACGAGATCCGCACGCCACTGATCGGG
ATTTCGGGCATGGTCAGCTTCCTGCAGGACACGACGCTCAACGAGGAGCAGCGCGACTACACGAACACGATCCAGAACAG
CGCTAGCAGCCTGCTGATGATTATCAACGACATTCTGGACCTGTCCAAGGTGGACGCGGGGATGATGAAGCTGAGCTTTG
AGTGGTTCCACACGCGGTCGCTAATCGAGGACGTCAACGAACTCGTCTCGACCATGGCTATCGGCAAGGGTCTAGAGCTC
AACTACATCGTGGAGGCCGACGTGCCGGGCTGGGTCAAGGGCGACCGGGTGCGCATGCGACAGGTGCTGCTCAATGTGAT
TGGCAATGCGATCAAGTTCACGGCGCGTGGCGAAGTGTTTAGCTGCTGCCGCGTGGTGCGTCCGTCGCCAGAGCCGGACC
GGATCGTGCTTGAGTTCTCGGTGACGGACACGGGCCAGGGCTTCACCAAGGAGGAGGCAGACCTGATTTTCAAGCCGTTC
AGCCAGATCGACGGCAGCAGCACGCGGCAGCACGGGGGCAGCGGGCTGGGGTTGGTGATCTCGCGGCAGCTGGTAGAGCT
GCACGGCGGCAAGATGGAGGGCACAGCAGAGCCGGGAAAGGGTTCGACCTTTACCTTCTCGGCGCTGTTTGGGCTGCCGA
CCGAATCGGACCACCCGAGCGGGGAGCTGGCGGCTTCGTGTCTGGACGGGCCGGTAACGTCGAGCAGCGTGGCATGGCCG
GGCATGGGAACCGGGACGGTATCGACGTCGTTCTTCCTCGCGCCATCGGCCGTGGTGGCAGCAGCAGCGGCTTCGGCAGC
CGGGTCTCCGGGTAGCCTGGCGTCGACTTCTGTCCGGGCGGCCAGCGAGCCGAGCAAGGCCGGAGAGGCCGGAGAGGCCG
GAGAGACGGGCGAGGCGATGGTGAGCGAGGTGAAATCGCCGACGACGACGTTTAGCAGCGACTCGGACATGCGCACGACC
AACCTGACACGGTTCAGCGAGGCGGCTCGGGCGAGTGGCCAGGACCTGTCGCAGATGTCGTTGAGGCACGTGGGAAGTGT
GGCTGGAGACGGGACTGAAGATGAGGCTGGAGCCGAGGCTGAAGCTGAGGCTGGAGCGGAGACTCTCCGCAAGAGGCCGT
CGGCCCTGTCGATCCTGATCATTTGTCCGCAGATGCACAGCCGTGAGGCGACGACGCAGCACATTGAGATGACGCTGCCC
AAGGGGACGCCACACCGGCTGACGTCGCTGGCAACTGTGGTGGAAGCGCAGGAGCTGATTCAGGGCGGCCACCCGGAGAT
GTTCACGCACGTGGTGATCAACCTGCCGTCGCCGCAGGAGATTCTGGACGTGGTCAACCAGCTGCACCAGTCGACGATGC
TGCAACACGCGAGCCTGCTGGTGCTGTCGGACTCGGTGCAGCGGCAGGCGGTCAACAAGCTGGCGGCGGGGACGCGGTAC
AACGAGCTGCTGTCGACGGCGCGGGTGACATACATTTACAAGCCGGTGAAGCCGTCGCGGTTTGCGGTCATCTTCGACCC
GGCACAGGAGCGCGACCTGAGCATCGACCACAACCGGTCGAGCGCGGAGCGGCTGGTGGAGACGCAGAAACAGAGCTACG
TGGACCTAGAGCAGCGCATGGGCAACCGGGGCTACAAGGTGCTGCTGGTGGAAGACAACCTGGTGAACCAGAAGGTGCTG
AAGAAGTACCTGCACAAGGTGGGCGTGGACGTGGACGTGGCCGCCGACGGGGTCGAGTGCGTGGAGGCTGTGCTGTCGCA
TGCTCACGAGCACTATTCGTTTATACTGGTGAGTGGGGGAGGGGGAGAGAGAGGGGGGGGGAGAGAAAAAGACAAAGAGA
GAAAGAGAGAACGAAAAGGAAAGAGAACGATGCTGACTGATAGTGTGATCTACATATGCCCCGAAAGGACGGCTACCAGG
CCTGTCGGGACATCCGCGAATGGGAGGCCACGACGGGCGGACGACAGAAGCCGATCCCCATCATCGCCCTGTCGGCCAAC
GTCATGTCGGACGTGCACGAGAAGTGCGTAGAGGCCGGGTTCAGCAAGTACATCACGAAGCCGGTAGACTTTGTTGCGTT
GAGCCGAGCGCTGGCCGAGTTTTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62