GenePrediction:GLEAN_5862 Details

Name: GLEAN_5862
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:480783..479483 (- strand)
Length: 1301
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:480783..480765 (- strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_173:480452..480340 (- strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_173:480286..479565 (- strand)
Length: 722
Type: CDS
Source: GLEAN
Position: GCSC_173:479498..479483 (- strand)
Length: 16
>GLEAN_5862 class=GenePrediction position=GCSC_173:480783..479483 (- strand)
ATGCCAGGCAAACAGTGGGGTAAGTGAGATGACAGAACTGCGTTTACCCCCCCAGAGCACACCCCCTCGCCTTAGGCTGC
GATTCCTGCGATGGCGACACCCGACCATAGACAAAGATGTGCGCATAAGCGGAAGCACGGCTGTCTGCAGAGATTCAGTG
GAGCAGCAGAGCAGAGACAGAAAGAGACGGGACGAGCATAATGGACGGCGCGCCGACATTCTGTTGTCGAGAGGGGGAAG
AACAGATGCGCATGATAGAGGACTGATTTCGTGCGCTGGGTCTATGCTGTCACAGTGTGAACATGAGCTGACGTTGACTC
CCATCTGACAGATGACGAAGACGAGTCGTCGAGCGGCTCGGAGGCCTCATCGAGCCCGGCTGTTCCGGCCGGTGCCCTGA
GACGGGCGACCAAGTTTGAGGACGAGGAGGACAACGACAGCGACGTATGTTTTATGGATCCTTCTTTCGAAATATGACTG
ACCGGCGGCGGCTGCAGGTGCTCGACTCGTGGGACGCGGACGACTCGGAGGTGGAGCGCGAGAAGGCAGCGGTGGCGGCC
AAGGCCAAGGCGGAAGCAGAAGCAGCCAAGGCAGCGGCAGCGGCGGCCAAAAAGTCCAAGGGGCTGCGGATTGCGGAGAA
ACAGGCACAGCGACAGGCAGAGCTGGCGGCGCTGGCAGAGCCGCGCGAAAACGAGACCGAGACCGAGCGGCGCGAGCGGA
TGCGGCGCCACGAGCAGGAGGCCGACCTGCAGCACGCGGCTGACCTCTTTGGCGACGCCGGACTCTCGGCTGGAACCGGT
AGCGGCGTGCGAAAGTCGGCGGCCGTGCTCAAAGCCTCGGCTGTGGCCGTCGACAAGGCCGACCCCAGCAAGACGGTCGA
TCTGGCGGCACTGCCGCTGCTCAACCCGATCACCAAGGCCCAGTTCGATGCGCTCTGCTCGACGCTGGCACCGCTGATTG
CGGCCAACGCCAAGAAGCCCCACTACTCCCTCTTCGTCCAGGATCTCGTCAAGGAGCTCTGCCGCGGACTTCCCAGCGAT
CAGATCAAGAAGGCGGCCAGCACTCTGACCGTGCTCAGCAACGACAAGCTGCGCGAGGAGAAGGCTGCCGAGAAGGGCGG
CAAGAAGTCCAAGGCCGCCAAGACCAAGACGTCGCTCGCCGTCGGCCGGCCCAATACCGTCGACACGGGTGCCTACGACG
ACGATGGCGGCTATGGAGAGTGAGTGTTATGCCTGCCCTTATCACGTGACTTAATGTTATGGCTGACTAACACATCTCGG
CGCAGCGACGACTTTATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62