GenePrediction:GLEAN_5863 Details

Name: GLEAN_5863
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:475803..474536 (- strand)
Length: 1268
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:475803..475737 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_173:475667..475467 (- strand)
Length: 201
Type: CDS
Source: GLEAN
Position: GCSC_173:475400..475352 (- strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_173:475298..475112 (- strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_173:475038..474937 (- strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_173:474865..474785 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_173:474707..474673 (- strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_173:474608..474536 (- strand)
Length: 73
>GLEAN_5863 class=GenePrediction position=GCSC_173:475803..474536 (- strand)
ATGCCTGCGCCGACAGCGGTGAAGAAGGACGAGACGGCCTCGCCGGCCGTTCAGGTGCCAGTGACGAGTATGGACTCTGG
TCTTATGTCTGCACTGCGATCGCTTGGGAGGCACGGCAGCTAACGGGAGGACGCAGTGGACCACGAAGACGATGTCGCGC
TCGATGCGGTGCCCGGCGTGACCCTGGTTGCGCTGGCAGACGACCCAGCCACAGCGACGGTTGTCAGCTTCGACAGCGAT
CCCGATGTCAACATGGACATTGACGAGGAGTCGCGGCCCCGGTTTGCGGCCGCCAAGGATGTCCAGACGGCTGTCCGGAG
AGAGTCGCGGAAGATCCGTGTGTTGTCCCTCTGTCCCCGTGCTGCATGGCCGTCCGCGCGATTGAGCTAACCCGCTGCTG
AAGCGATCCCGCCACACCGCATGACTCCTCTGAAGGCGACCTGGAGCAAGATGTACGTATGTGCTTTGCTGCTGTCTTGT
CGTGATGCTGACGGCTCTTCGCCAGATATACCCCCCTCGTCGAGAACCTGCGGCTGCAGGTGCGCATGAACATCAAGTCC
AAGGCGGTCGAGCTGCGCACGTCACGGAGCACTGTCGAGACTGGCGCTATCCAGAAGGGCGAGGACTTTGTGCGGGCATA
TGCCATGGGATTTGACGTCGAGGACGCCGTGGCCATCTTGCGGTTGGACGGTGTATGTTGACCTGTCAACTTTCTGTCTC
TTGCCTTTTGTGTCGGGACCGGAAGGGCTGACAGTTTCTGTACAGATCTTCATCCAGTCCTTCGAGATCAAGGACGTCAA
GTCGCTCGAGGGCGACCATCTGGCCCGTGCGGTCGGCCGCATCGTCGGCAAGGACGGCCGGACAAAGGTAAGCAGGCAGA
TGGACGGGTTGCAAACGGTGTTGTAGCCGATCGACAGGTGCTGACTCGAGATTTCCAGTACGCCATCGAGAACACGACCA
AGACGCGAATTGTCGTCGCCGGTGGCTCCAAGATCCACATCCTGGGCGGTTTCAAAGAGGTGAGACGAAACGACTTTGCA
GGAACTCGACGGCCCTTTGAAACGTGGGATGTACTAACAGTGTTTTCTGTCCTCAGATCGGCATGGCGCGGGAAAGCGTG
GTCAGCTTGATGTATGTATTGCCCTTTGGTCGCCTGTTCTTCGTGATCCGGGCAGCTCCACTGACATGCATCTAGTCTCG
GCAAGCCGCCCAGCAAGGTGTACGGCAATCTGCGGTCCATAAGCACCCGGATGAAGGAGCGGTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62