GenePrediction:GLEAN_5864 Details

Name: GLEAN_5864
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:471756..470635 (- strand)
Length: 1122
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:471756..471529 (- strand)
Length: 228
Type: CDS
Source: GLEAN
Position: GCSC_173:471460..471396 (- strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_173:471304..470635 (- strand)
Length: 670
>GLEAN_5864 class=GenePrediction position=GCSC_173:471756..470635 (- strand)
ATGGTGTCAACACAGCTTACTGACTTGCTCGCAGAGGGCCGTGTTGCGTTCGTAACAGGCGGTGCTGGCGATATCTGCAG
CGCTCAGACACGGGCATTGGTGTACCTGGGTGCCGACGCGTGCATCATCGGGCGCAACGTGACGAAGACAGAGGCCAAAG
CCAAGGACATTGCCACGGTGCGCAAGGGTGCCAAGGTCATCGGCCTCGGCAATGTCGATGTTCGGAATGTACGTACAAAA
GGGGCAGAAAGGGACGGTGTGTGTGTCAGGTGTTGTGCTGACGTTCTCGATTGCAGTTTGAAAGTCTGAAGCAGGCGGCT
GACCGCTGTGTGGCGGAGCTGGGCAGCATCGATTTTGTCATGTGCGTCTTACGGTCCTTCTCCTTCTTTTCCTGCTTCAG
CTTCATCTTTGCATTTTGTCCCTTCTCCACTCCTTCCACACTTCTCTAACAGAGACAGCGCGGGTGCGGCCGGCAACTTT
GTGTCCTCGCTGGCCGGGCTCACGTCCAACGGCTTCAAGGCGGTCATGGATATCGACACACTGGGTACGTTCAACACGAT
CAAGGCCACGGTCGACCACCTGGCCGTCTCGGCGAGCCGCCACCCGAGCCCCAACGCGACCGCCGAGCCGCCGGGCGGCC
GCCTGCTGGCCGTCTCAGCTACCTTTCACTACACCGGACTGCCGCTGCAGGCGCACGTGTCGGCGGCCAAGGCCGGCGTC
GACAGCCTGATGGCCTCAGTGGCGCTTGAGTACGGTCCGCGCGGCATGCTGGCCAACGTGATCGCGCCGGGTCCGATTGT
CGGCACCGAGGGCATGTCGCGGCTGTCAACCGTTGATACCGCCGAGTCGGCCCAGATGAGCGCCCGGGGTGGTGCACCCC
ATATTCCCAGCGGCCGCTGGGGTACTGTCCGAGACATTGCCGACGCCACCGTGTTCCTGTTCAGCGCGGCCGCCGACAAC
ATCACTGGCCACGTGCTCGTGGTCGACGGCGCTGCGTGGCGGCGGCAGACCGGCTCTGTCGGCGTCGGCCTCGGGCCAGG
CATGGAGTATCCAAATTACCTGCTGGGCGATGGGAGCAACGACAACGGGCAGAAGCCGACAGGCGGAGGTGCTAAGCTGT
AG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62