GenePrediction:GLEAN_5865 Details

Name: GLEAN_5865
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:468847..467414 (- strand)
Length: 1434
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:468847..468296 (- strand)
Length: 552
Type: CDS
Source: GLEAN
Position: GCSC_173:468211..467414 (- strand)
Length: 798
>GLEAN_5865 class=GenePrediction position=GCSC_173:468847..467414 (- strand)
ATGCAGCCCGCCTCTCTCAAGGGTGTTCTAGCCGTTGCGGCCGTTGCTGCTGCCCAGAGCCAGGGCTCTCATGCCGACTC
TGCCATTGCGAACATGAAGGCGCACATCAAGCACGTGGTTCTTCTCGTCATGGAAAACCGCTCGTTTGACAACATCCTGG
GCGGCCAGACACTTCCGGGCCTAGACAACCCCTACCACAATGGCCCCTACTGCAACCCGTACAACCTAACGGATGCGTCA
AAGGGAACAGCCTGCTCTGAGGCCAGAGACTACGACTCCATCGCCGACGACCCAGACCATGCCGTCTACGGAAACAACAT
TGAGTTCTACGGCACCTTTAATCCGGACAACGAGGCCATCGCGTCCGGAAAGCTGGTCGCCAAACAGAACGGCTTTGTAC
ACGAGCAGCTTCGGCTCTATGACGCCAAGGTCAACCAGACCACGCTGTCCGAGCAGGTCATGAACTACTACACAGAGAAA
CAGGTGCCCGTGCTCACGTCTCTTGTGCAAAACTTTGTCACCTTCAACTACTGGCATTCGGCCATCCCAGGTGTAAGTTG
TGTCGTTTGTTCTGTTCTTTCTTTCTTGAAGATTAGAAGAATATTTTCCATCGCCTTCGCTAACAAAAGCATATAGCCTA
CCGATCCCAACCGCATGGCCATCGTGGCGGGAAGCTCGTTCGGTCATGGTGTGAACGATGCCGGCTTTTCGGCAAAGGGC
TTCAACGAGACGTCCATCTTCCAGTCTCTGACAGAGAACGGCTATGACTGGCGCAACTATCACGATCCCGCCGGCGGCAC
CGGCCCGGAAGCACAGTGGTTTCAGTGGACGTACGACGCCGGCGTGGACAACAAGGTGGTCAACCTGGACCGGTTCTACG
TCGACGCCGCCGCCGGCAATCTCACCAGCTTCAGCCTGATCAACCCGTCCTGCTGTGGCGTCGGCACGACGTCGATGCAT
CCGACCGGCCTCGTGTCTGACGGCGAGGGCCTCATCAAGGACGTGTATGACGCTGTCCGTGCCAGCCCCCAGTGGAACGA
GACGCTCTTCATCATTACGTACGACGAGACCGGCGGCTTCCACGACCACGTGGTACCGCCTCTGGCTCCCGAACCGGACA
ACCTCACCTACACGGCCACCACGCCAGCAGGCCAGGACTACACCTTCCACTTTAATCGTCTGGGCGGCCGCATGCCGACC
TTCCTCGTCTCGCCCTGGGTCGAGCGGGCGCATGTCGAGGGCAAGGGCACGAACGCGGCCGGCGAGACCGTGTCGTACTC
GGCCACATCCATCCTGCGCACCCTCGGCTACTTGTTCGACTTTGAGCCATACAACCGCCGCGTAGAGTGGTCCCCGTCGT
TTGAGCATCTGATCACCAGCCGTCCTCGCTGCCCGATTGATGTGCTCCCCGAAGGCAGACCATTCCGGGCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62