GenePrediction:GLEAN_5866 Details

Name: GLEAN_5866
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:458872..456846 (- strand)
Length: 2027
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:458872..458600 (- strand)
Length: 273
Type: CDS
Source: GLEAN
Position: GCSC_173:458474..456846 (- strand)
Length: 1629
>GLEAN_5866 class=GenePrediction position=GCSC_173:458872..456846 (- strand)
ATGGCGACTATCGCCAACTTGGAGGGTCTTCTGGCCGGAATCGGACTAGAGACTCCAGTGCCGCAGTACCAGGCGGCTGA
CATACTCGCCAAGCCAATCGACATTTACCGCAGCTACCTGGCAGCATTTCTCTCATCTGCCCTCACTCTAGACGCTGCTA
TGGTCTACGAAGCAATCAATGTGACGAGTGACGTCTCTAGGAGTGATCTTGATGTGGTCATACCTCGCCTAAAGCTTGAG
ACCGCAGATGTTAGGCGGGATCTACGTTCTGTCGTAAGTAAACCCGTTGCGAATATGTCCTCTGGAAGATACAAATGCTG
ACAAGACAGCATTCCCCACCCCTATTCGAACCTCTTTTTTTCGAAGGTGTACGCGTTCATTTCCCCTACTCATCTAAGAA
CCTACCTCGCTTGTTGCTGCCCTACATCAGCAGCCGTGGCGCTTCGTACGGCCAAGAGACCTCACATGGACTGAAAGATC
CGTTGGCGCCCGAGAAAGGTCGGAAGAAAGTCGTGGTGGAATTCTCATCACCGAGTGTTTCCATCGATTTCAACGATACC
CATCTGCGTAGCACAATCGTCGGCTCTTTCGTTGCCAACCTGTACGAGTGTATGGGATGGGATGTTGTTCGGCTCAATTA
CCTCGGCGACTGGGGCAAGCCAATCGGCCTGCTTGCTGTGGGGTGGCAGCGCTATGGCTCAGAGGATGCACTGAAGGAGG
ATCCTATCGGCCACTTGTTCGACGTATGTTCCAAAATCAGTGAGGATTTTAAGCCGGAGCAGCAGGCAAGCAAGAAGGCC
AAGGAAGACGGCTTAGACACGGCCGGGATCGAGGGCCAAGGAATCTATGCTGAGCGCGATGCCTTCTTCAAAATGATGGA
AGAGGGAGATGAAGAGGCCCTGGCTCTGTGGAAGCAATTCCGCGATATTACCATCAGCGACCTTGAGAGCGCCTACAAGC
GGATGGGCGTTCGCTTCGATGAGTATGTGGGTGAATCGCAAGTGAAGCCGGAGACCATGGCCGAGGTGGAAGCTGTCCTG
AAGGAGAAGGGGGTGCTTGAAGAGAGCAATGGGTCCTGGATCATTGACTTTCCCAAGCACGGCGGCAAGAAGGGGCTGGG
CATTGCCATTATTCGCGGGCGGACGGGCTCGTCGACGTATCTGCTGCGCGACATTGCGGCGGTGATCGACCGAGAGCGTG
CCTACGGCTTCGACAAGATGCTGTACGTCGTCTCGATCCGACAGGAGACGCACTTTTCCAAGATCTTTACCGCCCTGGAT
CTCATGGGCCGTTCCGACCTGCTGGACAAGCTTCAGCATGTCAGCATTGGACGGATCCAGGGTATTTCTGAGCGGATCAA
GGATGCCCACACTCTGGGTGCGATTCTTGATCAGAGCGCCCAGCTTATACGCGATGCCATGGCCACTGGGAAAGAGACAA
GCCACGGGGGCGAGTCTGGTACGCCGCCGGCAGAGGAAGTCGTTGCCGCTGTTGCTGTTGGTGACAGCATAACAGTCGGT
GCCCTGTTCGGCCAAGATATGGCGCACAAGCGCATCAGCAGCTCCGTCTTCGATGTCAGGCGGATGGCGTCTCTGGACGG
AAACACGGGACAGGGGCTGCAGGCCAGTCACACGCAACTCGCGCTCGTCATTAGGAAGCTAAAAGAGCAGATAGCCGGCA
CGCCCGAGACTGATCAAGCTCCACCGGAATACGACTCCCTGCAGAAAAATGAGGCGGTGGATCTCTTGCGTCTGATGGCG
CAGTATCCGGACGTGACCACTTCGGCGTTTCGCTCGCTGGAGCCACATGCAATACTGTCATATCTGTACCGCCTTAATGA
TGCCATACACTCTTGCATCAATCCATCGGATGGAGAAGAGGAAGGTGGAGATGCACCGACAGAGGCGGCCAGCACTGTGG
AGCCGGAGTCAGTGGGAGAACAGAAGGCGTTTCTGTCATTGTATGAAAATGCGTGTCAGGTGCTCGAGAACGGGCTACAG
CTGTTGAGCATACCTACCGTGGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62