GenePrediction:GLEAN_5867 Details

Name: GLEAN_5867
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:456066..454550 (- strand)
Length: 1517
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:456066..455433 (- strand)
Length: 634
Type: CDS
Source: GLEAN
Position: GCSC_173:455382..454550 (- strand)
Length: 833
>GLEAN_5867 class=GenePrediction position=GCSC_173:456066..454550 (- strand)
ATGGCTCGATCTCTCTTTGGCGCAGCCGTGACGGCACTGCTGCTGGCGCCGGCTGCCGGCGAGTCGGTGCTGGGCATCTA
CGTATTCCACCGGCACGGCGACCGGACGACCAAGTCGTGGCCGCCGACGGCACTGACGGCCCTGGGCGCCGACCAGCTCT
ACCTCTCGGGCGACTACTTCCGCGATCGGTACGTGAGCAGCAACGCAACCAGTCCCGTGGTGACGATCTCGTCGGACCTC
GTCAAGCTGTCGCAGATCAGCGTGACGTCGCCGGCCGACAACGTGCTGCAGGCATCGGCAGGCTTCTTCGCCCAGGCGCT
CTTCCCGGCCGCCGGCTCGTCGTCCCAGCAGACGCTCGCCAACGGCACCGTGACCGAGAACCCGCTCGGCGGCTACCAGT
TCGTGCCCGTCAACACCGTGGCCACGGCCGCCTCCAGCACCGGCAGCGAGGACAACGGCTGGCTCCAGGGCAGCAGCGGC
TGCGGCAATGCCGTCGTCAGCAGCAACAACTACTTCTACAGCCAGGACTACCTCGAGACGCTCAACAGCACCGCCGCCTT
CTACCAGGACCTGCTGCCGGCTATCAACGGCACGTTTACGGCGCAAAAGGCTACGTTCAAGAATGCCTACACGAGTGAGT
GGACTTCTCTCTTCTCTCCTCTTCCTCTGATACTAACTCCCCAGTCTTTGACTACATCCACGTTTCAGAGATCCACAACG
CCACCATCTCGAGCTCTGACGTCCTCACCGACGACGTCCTCGCCCAGGTTTACACCCGCGCCAACCAGCACGAATGGGGC
CTCGCCTACAACGCCAGCGAGCCCATCCGTGCCATCTCCGGCGCCGTGCTGGCTGCCCAGGCTCTCAGCGCCCTCAATAC
CACCGTGCTGGCCAAGCCGACCGCCTCGTCCGTCTCGCGCCTCAACTTCCAGTTCGGCGCCTACGGCACCTTTATGAGCC
TCTTTGGCCTTATGGACATGCCGGCCGCCAGCCCGCTCTTCTACGGCATCGTCGACTACGCGTCTGCCGCTGTCTTTGAG
ATCGTCACCAACGCTTCCGTCACCGATGCTGCCGCCATCGATCCCAGTGAGATTTCCGTGCGCTTCCTCGTCGCCAACGG
CTCTGCGCCTCTCGTCGGTGGCCTGACCGCCTACCCCATGTTTGGCACCGAGGACGAGCTGATGCCGTGGGCCAACTTCT
CCGCCGCCATGGCTAACATTGCCGTCGGTGACACCACCACGTGGTGCCAAGTCTGCGGCAACACCACCGGCATCTGCAGC
CCCATACTCCTCGGCACCGCCTCCGACTCGGACAACAGCTCCAGCGCCAGCAGCTCCAGCTCCAGCGCCAGCAGCTCCAG
CTCCAGCCACCACCACCACGCCGTCTCCCGGCCCGTCGCCGGCGTCATCGGCGCCGTCGTCACCCTGGCCGTCGTCTTCT
GTTTCGAGGCTCTCGTCATGGCCGTTGCCGGTCTGCGCCTCGTCAAGAAGGGCGCCGCCGTACCCAAGGCAAATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62