GenePrediction:GLEAN_5869 Details

Name: GLEAN_5869
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:446864..444439 (- strand)
Length: 2426
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:446864..445511 (- strand)
Length: 1354
Type: CDS
Source: GLEAN
Position: GCSC_173:445397..444439 (- strand)
Length: 959
>GLEAN_5869 class=GenePrediction position=GCSC_173:446864..444439 (- strand)
ATGCCGCGACCGCAGCGCAGCCGTGCGGCGGCATTGAAATCGAGGCAGCTGGCGAAACGAGGCGCTGAGGCTGTTGCAGG
ACTCGGAGCAGACGAAGTAGCTGGGGGAAGCTCAGACGACAGCTACGACGACGCGAGCCACGGCTCGGTCGAGAGCAGCG
ACGGCAGCCATTCGGACGCGGTCGCAGGGCCATCGCCTGCAGGCAGAGGAGGACGTGTGCGCCAGCGCGACCGACGAGGC
CGAGGTGCAGAGGGCGCTGAGGGTGCGTCCGAGTCTGGGCCAACGCGATCAGAGCCAGCAGCAGCAGCAGCACAAGCACC
AGCACCACCGGACGTCTACAAGATCGCTGCCTATCCGCAGGATAGCCGACGGACGCGACTATACGCGGGACCGCTGAAGA
AATGGGACCGGTACCGATCGCTGATCGAGATCCTGTACGGACCCGACCCCGAGGCGATTGGCATCGTCGACAGCCTGCGC
CACCACTGGATCGGCTATCCGGTGCTGCCGAGGAAGACGTCGTATCAGGATAGCGGAGAGGGCGAGACGGGCGACGACGA
CGACGGCGACGACGACGATGGCGATGGCCAGCCTAGGAATTCGCTTGGGGGGATGCAACCGAGTCCGTGGGTGTCGGACA
GCTTCGAGGCCGACCAGGCGGCGGCGTTCCATAGCTGGTACGCCGAGCCGGACAATCAGCAGCAGCAGCAGCAGCAGCAG
CAGCAGACGATAGCCCTGAGTGCCGAGACGGCGCAGCAGTATCTCTCATTGGCGGCGGCCGGCGAGCTGATCGCATTTCT
GGGGCCGACATCGCGACAGCAAGTCGTCCAGTTTCGGCCGGGCAGCTGCGTGGCGCTGCAGGAGAGCGGTTACCCCGATG
GGGGAGGAGAAGGAGGTGATGGAGGTGAAACAGACGGGAAAACGGCCGGCTGGATGCTCGATGCGGGTGGCATCGTCGTG
GCCACGGCCTGGGCACCGCTCACCGGCCGCGTCGACCAGCTGCTGGCCGTGGCTGCTGTTCCGCACGGCGACCAGGAGCC
GGCTGGCAGCGGGCTATCTGCAACTGTCCCCGACAGCGGCAACCAACAAAAACAGGGCAGCATCCAGCTCTGGCGGGTGG
CGCTCGACGCAGCGTCGGCCAAGATGAGCAGACGGCGGCCACGTGACCCGGTCCTGGAGCGGGTGCTCCTATTTGAGTGG
GGCCGGCCAAAGCGGATGCAGTGGTGTCCGGTGGCGCTGGGGACGTCGGCCACGTGCGGGCTGCTGGCAGTGCTGACGGG
CGACGGGATGGTGCGGGTGGTGGAGGTGAAGCGAGGGAGTGGAGGAGGTGAAGGCGGAAGTGAGGCGGCGTATGGTGAGT
TCTGTTTGTTCCTGTCTTTGTCCGCCTTCATCTTCCTTCTTGTCTGTCCTCTTTTGTTTCCTCTCTCCTTCTATCCTTTC
TTTTCTCTTATTCATCCTAACCGCCAGACTGGATCTCCCATCCGATTGCCACCCTTGGCCTCCCCGACGAATACAATGTG
GCAGCCACCTGTCTCACCTGGCTGGGCCTCAACCGGCTCGTCCTCGGCCACACCGACGGCTCGCTCTCACTCTGGTCGGT
GCGTCCGCGCCTGCTGCTGCAGCGTCTCCCAGTGCACGCGACCCACGTTCTCGACGTCTGCTCCGGCTACCCGTCGTATC
CCTACATGGTGGCCTCTCACCCTGTTGGTGGGCTCGCCCGCCTCGTCGACCTGACCCGACCCAGCAGCGAGCACACCTTC
CACCCGTCGCCCATGGTGACCTTCCAGCCGGGCTTGTTGCAGTGGTGCGACCACATGCTCGGCTTCGCTGCCGCCGCGCC
GTCCAACAATCCGCGCAACGGCCGGCTCGACTTTCTGCACGTCCGCTTCTATCCCGGCTCGCGCACCTTTTTTCCCGGCC
GTGGCCTCGCACCGCCCATCTGCCTCGCCGTCGGCACCTCTCATCCTTTTGCCCTCGTCGGCCGCGCCGACGGCAGTCTC
TGGGCCTGCAACGTCATGCAAAAGGTCTTTCGCAACCGCGCCGACCTGTCGTACCGCCTCAAGATCGTCGACGTCGAGTT
TCGCCCGCCCGCCAGCGAGTACCGCCATCCGTCCGTCCGCGGTGCCGTCCGCATCCTCCACGGCTTCGAGCCCGAACGCA
ACGAGCAGCCGGCCGCACAGCCGATTGCCAGCAGCAGCAGCAACGCCCCCAAGGACTACGCCAGCAGCAACAACGACAGC
GACGGCGGCCCGCCTTCCAACGACGCTGGCAGCGACGCCGAGCAGGAGTCCGGCCAGGCCGTCATCCACGACCCCCTGAC
CCGCATCTCGGCCGTCGCCTGGAACCCCAACATCGAGTACGGCTGGTGGGCCGCCGTCGGCATGGCTTGCGGTCTCGTTC
GCATCGTGGATCTAGGCGTGGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62