GenePrediction:GLEAN_5872 Details

Name: GLEAN_5872
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:422910..422558 (- strand)
Length: 353
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:422910..422889 (- strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_173:422817..422728 (- strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_173:422652..422558 (- strand)
Length: 95
>GLEAN_5872 class=GenePrediction position=GCSC_173:422910..422558 (- strand)
ATGGGTGGCGCAAATCGTGAAGGTGTGTTAGCTCCCTGCTGCACTGCAGCAGCCTCGATGCAGCCGGCCCAGTCCTGACT
GACAATGTACCAGGCGGCAAGGCGAAGCCGCTCAAGCAGGCCAAGAAGGCGACCAAAGACATGGACGAAGACGACAAGGC
ATACCTGGAGAAGAAGCGCGCCGGTAAGGATACAAGTGCCGACAGGCGATGGGCGATGGGAGATAGGTCAACCTGCTGAC
TCAGGATCCCGCAAACAGAGGAGAAGGCTCGCAAGGATATGGCCGACAAGGCCAAGGGCAAGGGTCCCCTCAACACGGGC
GCCCAGGGAATCAAAAAGAGCGGAAAGAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62