GenePrediction:GLEAN_5873 Details

Name: GLEAN_5873
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:421888..420656 (- strand)
Length: 1233
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:421888..421244 (- strand)
Length: 645
Type: CDS
Source: GLEAN
Position: GCSC_173:421171..420893 (- strand)
Length: 279
Type: CDS
Source: GLEAN
Position: GCSC_173:420829..420656 (- strand)
Length: 174
>GLEAN_5873 class=GenePrediction position=GCSC_173:421888..420656 (- strand)
ATGGCGGCCGCCTCAGCATCTAGCCGTGTCCAGAGGCGGGCCACGAAAGAAGGCGCCCAGGGCACCCTGTCAGCAGCGGG
CTCTGCAGTCGACTCTCTCACCAAACCTGTCAGTCCACCCGGGCCGTCCGGCCGCCCCGGTCTCCTCCACTGGGACGACC
TCCCGGCCTGGCGCCGCGACAACGTCTTCATCCGGCACGGCTATCGCCCGACGTCCAACAGCTATGCGGCGTCGATATGG
AGCATCACGGCCGTGCACAACGAGTCGGTCAACGTGTGGACACACCTTGGCGGTGCCGTCGTGGCCGCCGTTCTGGGCGG
CTGTCTGTATCTCGAGCGGGGGCCGATTCACGAGACGGTCGGCCGGCTGGCCGGCGATGGGAGCGTGCTCGCATTGGCGC
TCCTGCCGTCCACCCAGTCGGCCTCCTCCCTGCTCGTGCTCTCCTGCTTCGCCGCCGGTGCTGTCGCCTGTCTTGGCATG
AGCGCCACCTATCACGCCCTCAGCAACCACAGCGCCTCGGTTGCTCGTTGGGGCAACAAGCTCGACTACTCCGGCATCGT
TCTCCTCATCGTTGGCAGCTACATGCCCACGCTCTACTACGGCCTCTTCTGCCATCCCCGCTGGCTGGCCGTGTACATGT
ATCTGGTAAGGCTATATGACTCCCCCTCCAACACTCTTCGTTCATCCTACACCCACAGTCTTACTCACACTCGTCAGATC
ATCCTCCTTGGCCTCGCCTGCCTCGCCGTCTCCTGGCTCGACCACTTCCGTACTCCTCAGTGGCGCCCCTATCGTGCCAT
GCTCTTTGTCGGCCTGGGTGCCTGCGGTGTCATCCCCATCGCCCACAGCCTCTTCTTTCTCGAGGGCCGGGATATTGCCG
CCGAAGGCTTCGTCGACTCGCTCGCCACACGCTTCCACCGCCTCGACGCCCGCATGGGTCTTCGCTGGGTTCTCCTCCAG
GGCGGCCTCTACATCTTCGGCGCCTTTCTTTATGCCGTATGCAACCATCACTATCCCTTTTTCGTCCTGTTTCTTTTCGT
CGGCTGACTAATACGATAGGCCCGTCTGCCCGAACGCTTGCGTCCCGGCCGCTTCGACATCTGGGGCAGCTCACACCAGA
TCTTCCACGTCTTCGTCCTCCTGGCTGCTGCCACTCATCTCCGCGGTATCGTGCAGGCATATACGCACCACCACGTCGCC
ATGGGAGCCCAGTGCCCGGTCCCACCACTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62