GenePrediction:GLEAN_5875 Details

Name: GLEAN_5875
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:409165..406012 (- strand)
Length: 3154
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:409165..408838 (- strand)
Length: 328
Type: CDS
Source: GLEAN
Position: GCSC_173:408712..407399 (- strand)
Length: 1314
Type: CDS
Source: GLEAN
Position: GCSC_173:407318..406012 (- strand)
Length: 1307
>GLEAN_5875 class=GenePrediction position=GCSC_173:409165..406012 (- strand)
ATGTCCACCGAGCCACAGACTCGCCCGACGCCCTCCCGTGGCGGTCGGGGTGCCAGCCGAGGTGGCAGAGGAGGTTTTGG
CAGTCGGGGAAGCACGCGTAACCGAGACCGGCCAGCAGGCGCGACAAACGGCGACGCACCCCTCAAGCACGATGACAGCC
TGGCCGGCATCGAGGACGAAGGCGAGATTGGGCAACTGAAGAAGCTCTATGGAGCTAAGACGTCCTTGATCAAGGAAATG
TTCACCGATTGGTCCGAGGTCGACATCCTGTTTGCCCTCCGCGAGACTGACGGAGACGAGAATCTGACGGTCACCCGAAT
TGCTGAAGGTCCGTATTCTCGCAACTCTCATCATGCTCTCCCCCTCCCTTCTTGCCACCCGCATCTCCACACGAGCTCTC
TGGCAGAGCTCACCCCCCCTCTTAGCCCTTTCTGACAAAACTGCACATCACAGGCACCATCTCGCAATGGGACGAGGTCT
CCAAACCTAAGAAGGAACGTGCGAAGCCGAAGCCCTCAGCTGCAGGCGAATCAGCTCCCGGCAGCAACTCCAGGACTGGC
AGGACCACTGGGGCAGCCGAACGCACTCGTGGACGGGCCAGGACAGTCGAGAGAGGCGGCCGTACTCCACGTGGCCGCTC
GGCTCAGCCTACAAACGGAACCCGCCCCGAGAAAACCCAGCTCTCCGTACCGACGGAAGAATCGCGGGCCTGGGAAAGCA
ATCCCGAATCCAACGATGACAGCGTCCCCCCTAATACCACGCCGGCCCTTACGACTAATGAACCCGCTTCTACCCCCGCC
CCCACCCCCAAGACAACTGCCCCTGAATCAACTACTCCAGCACCGAAGACCTGGGCAAGCATGCTTCGCCAGTCGGCAGC
ACCGAAACCTGTTGTGAAGCCCAAGGAAACTCCTCCGGTACCGAAACCCGCCCCCGAAACGATTGAAACTCCCCCCTCTC
AACCTGCCACCGCCGCCGTCGCTTCAGCGCCCACCGAGGCGGAACCAGAACCAGTAGCCGAACCCGAAGAACCAGCACAG
CCAGCCGTAAAGGAGGAAGTGGCCATTCCAGAAGTTGCCGTGCCCGCTGTTGCCATACCGGACGTCGCCGTCGCACCAAG
CCAGGACAAGCTCACGGAGAGCAACCTGGAGCGGGTGACCGACACCTCCACCCCCCTCACTACCGACACCATCCGCAGCG
AAGCCGCCGACTCATGGGATACTCGCGGCACAGCGTTGGCCGGAACTAGCTCGCCGGCGCCTGCAACCCAGCCAGCAGTC
GGATCTCTGCCCAAGAATGCAGGCAGCGGATTTGCCACGTCTGCACTCAAGGCCACTGACCGTGCGGCTGTCCGGACGCC
CAGCTACTCCCGCCGGGTGCTCGACCAGGAGGAGGCTGTGCGCATGCCAGTCAACCGCGAGGTCGACCGTGCCACTGTGC
AGTTTGGCGCTCTCAACTTTAGCGGCGGCGACGACGATATCGACGGCGACCGCGAGGAGCCGGAGACACGTGCCCAGCCT
CCCGACGACTCTCCTACCGCACACCCCCGTGCTGCCCTCCCGCCAGCTATTGCGCCTTCGGCTGTTTCAGACACATTCGC
CGCACAGCGGCCAGCTGCCCCGGCGGCCACTGCTTCCGTCCTGCCGCCCACAGGGCCAGCAGGTAGCCACACTGTCAACG
TCCTGCATGCTGGAGAGCTTCAGACTAACACGTTATCAGCAGCCGTCCCTTCTGTTCCCCAGCAGGCCGCTCCGTCTGCC
GCCCAAGGTAAGCTCCAGAAAGCGTTGACAGCTTCACAGCCGCCAAGGCGGTCTTTTGCTGCCCCAACTGACCCACATAC
TCTGCAGCCCAATCGGTGCCGGCAGCACAGCCGTATGGCCGCTTCGCTCAGGAGACGGCATTTGCCCAGAAGCCGTTCGA
CGCCTACGGCCAGCCAGCAGCCACCCCCCCATTCGACAGCTTCCAGAACGTGCCCGCTTCGTCTCAGCCGCAGGCGCAGG
CCCAGCAGGCCCAGGCCGCTTACAGCTCAGCCCCTGGCGACTACTCGCAGTACTACACCTCTGCTGATGCGCAGAGCCGG
GTGCCGTTCAACTACTACAACCAGGCCTATGGCCAACATGCTGCTCAGGGACACCAGGATGCTCTCCAGAACCAGCGCCC
TTATGGCGGATACCCGCTGAATGACTCTCTCAACCAGTACCCCCAGAGCAACGCGTCCCGATTCGGTGCTGCTGCCGCAG
GCGCAGCGGCCCCGGTGGTTGCAGATGCTCAGAACAGCGGATCGACCACGCCCAACCCCCCTGCTCCTGGCCAGCCCCAA
CAGGCGCAGCAGCCTGGCGCGGTCCAGAATGGTCAAGCCCAGTCTCAACAGCAGCCTCAGGCCAGCCAGTACCCGTACAA
CCACCCGTACTTCACCAGCCCGTACTACAACCAGTACATGAACCAGATGAACCAATACGGAAGCTTCGCACAGGGCAACT
TTGGGCCGTACGGCAAGGGATACGGCAACCACCACCCCGGCTACGGCGTGACGCCGACGCCGTATGAGCACAACATCTCG
CAGGCGTCGACGTTTGCAGCCGGTTCGTCTCTGCACCGCGGTGCCGAGACCAATTCTCTGGCAACCGGGCTGGGCGAGTA
CGGCCGCGTCGGCTCTGGCCAGCCGTCGAGTTACGGCAGTGGCCATGACGGCAGCTTTGGCCGTGCAGGCGCTGCGGCAT
ACCAGGCGCAGGCGGGCCAGGGATTCGGAGCGCCGCCTTCGCAGGCAAGCGCACAGCAAGCCGGTGCGGATGATCTGAAG
CCGTACGGCGACCCCAAGGGTGCTACTGGGCCGAGCCCGTCGCTCGGCGGGGCGCGTCCAGGGTCAGCCACCAACACGCA
GGCATCGCAGCCGGGGCTACCGCCGCCGCAGTCTAGCCAGCAGGGTATCAGCAGCTACGGTGGCTACCCGACTCACCTGC
AGGGCCACAGCGGTCTCCACGGCAACCAGTCGGTGGCTGGCGGCGGCTATGGCATGAGTGCCGGAGCCAACCAGAGCCAC
ACGAACAACCCGTACGGCGGCTACGGCGGCCACGGTGGCCACGGCCAGGGTTTCGCTGCGAACAGCTACTATGCGAACCA
GCAGCAGCGCGGGTGGGGTGGCAACTACCACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62