GenePrediction:GLEAN_5876 Details

Name: GLEAN_5876
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:405065..403344 (- strand)
Length: 1722
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:405065..405002 (- strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_173:404937..404892 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_173:404816..403598 (- strand)
Length: 1219
Type: CDS
Source: GLEAN
Position: GCSC_173:403535..403344 (- strand)
Length: 192
>GLEAN_5876 class=GenePrediction position=GCSC_173:405065..403344 (- strand)
ATGGACAAGCCAGCGCAGTCGGTTCCGATCCGGGGCCATGCGAGGAACAAGTCGTCGACCGTGGGTGAGCTGCCGTCCCC
CTTTTCCAACCGTCACGAGGGGAGTGCCTAACAGGGAGCGATCGACAGCCACGAGGCCCCGGTCGTCGACCAAAGGTCCA
CTGGACATGGAAGAGTATGACATGCCATTCGGCACGCTGTGATTTGTCCGTCGCTTCCGCTTTGCTTACATCTGTCTGCG
CGTATTCAGCAAGAACGTGCCGGTGTCTGTGGCCACGCAGCAGCCAGAGAGAGCGGCTGCTGCTGCATCGTCGCCCGCAT
CGATGTCGATGTTGTCGCCTTCAAACCGGCGCCAAAGCCGGTCGCCGGCCCTGTCGCCGGGACTGCGGTCACCGCTGCCA
CACTTGCCGGCCACCCGGTCGGCGATGGGTGGGGCCACGACGGCCGAGGCGCCGCGGCCCAAAGACTTTTCCTTTTTGCT
GAAGCCGGCCATCTACCACCCGCTCTCGATGGCGAGCCTGCCGCCGCCGTTTCGCAGCTCACCGCAGCAGCCAGCACCAG
ACACGCCGCTGGCCGATCTGCTGACGGCCGGCCAGTTCCGGGCTGCCGCCATCGTGGCCGCACAGCAGCTGACGGGCTTG
GGAGGCGGCTCCGAAGACGAGAAGGAACGGGCGATCGACCCGACCGACCACGGCCGCATCTTTGGGCTGCTGTACACCCG
CCTGGCCTGTCTCGTGCTGATCGACGCCATGCCGCTGGCCGCCCAGGAGGGTCGGGCTCTCGAGGACCTCAACAGCAGCT
TCTACTACGACGCGGCCACGGGTGAGCACCTGGTCCCGTGGGAGCTGCGCGTGCTCAACGTCCGGCTGCAGGCGCTCGGT
TTTGGCGATCCGCGCCGCGCCATCATGAGCTACTACGACCTCGCCCGCGAGTCTCGTCGCCGTGCCGCTGCCGCGCTCGC
CCGCCACGATCACTCGGCCAGCGAGCTGTGGAAGGGCCGGCTGGCCGAGCTCGGGCTCAAGGTCGCCGGCGCCCTCATCG
AGATGGACGACATGGCCGGCGCCGCGGCTCACCTGACCAGCATGGCCGGTGGAGGTGGTCGTGATGGGCCTGAGACGGGC
ATCGGTCGTGACGATGAGACCGAGGCTGGCTTGATCACCACCCGCGGCCGCCATCCTGTCCCGAATCGCCGTCTCGAGGC
CGCTCGTGCCCTCCTATGGCTGCACATCGGCGACGTCGAGGCTGCCCGCGCAGAGATGCATCGTGTCGCCTCTGTCGCCG
CTGCTGATCCGTCTGCCGACGACAATGACCTCGGCCCTCGCATCGTCTCGGCCCTCTGCGATATGGCCGATGATGACTAC
GCTTCGGCTCTGGTCACGTGGCGCGATCTGCACCGAGACGCGCCCGCGGACGAGATGATCGGCGTCAACCTGGCCGTCTG
TCTGCTCTACGTCGGCCAAATGCAAGAGGTCAGTCTTTCTCTTTTTTTTCTTTGTTCCCGTCTCTCCTTCCTTTCTCTAA
CACCCCCCAGGGACGGGCCGTCCTCGAGAGCCTCGTCGATGCCGGCTACTCGTCCCACACGCTGCTCTTCAACCTCTCCA
CCATGTACGAGCTCTGCAGCGACCGGTCCAAGAGCTTGAAGCAGCAGCTGGCCCAGCGCATGGCCGACAGGACCCCGTCC
ACCGACGGCTGGGAACGGGTCAATGCTGATTTCAAGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62