GenePrediction:GLEAN_5877 Details

Name: GLEAN_5877
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:401839..399435 (- strand)
Length: 2405
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:401839..401617 (- strand)
Length: 223
Type: CDS
Source: GLEAN
Position: GCSC_173:401551..399435 (- strand)
Length: 2117
>GLEAN_5877 class=GenePrediction position=GCSC_173:401839..399435 (- strand)
ATGGCGTCCTCTTCTGGAGCGGACGCGGGAGGTCCCTCGAGGCAAAACGATGGCACCGAGACCTCGCCGCTGCTCGGCCA
CCCCGATGAGGCAGCTGTGCCGGAGACGGGAGCAGCCCAGAAGCTGAACCAGACGTACGACATTTTGAAGAAGTATCTGT
CGGCCATTGGCATCTTCCGGATTCTGGCGGTGTTTCTGATTGTAGGCGTTGTTCTCACTGCCGGTAAGGATGCAATGCTC
TCTGTCGGCCAGCCATTCCTGGGACCGTTATACTGATGCGTGAGACAGCTCTCTGGCCACGGACAATCCCCGGCTCAGGC
GTGGCACTTTGCCTGACGCCGGCCTGCATCCACGCTGCATCGGAATACCTACAGAACCTGTCGCCCAACTACACGAACAT
CGATCCCTGCACCGATTTTGAAGAGTTTGTCTGCGGCGGGTGGCACGAGAGCCACGATATGCGAGCAGACCAGGGCATGA
TTGATGCACTCGGACTCATCGACGACAGGGTGACGTCGACGATCAGACACATACTGGAGGGCGACTACCCTGGATCGTCG
AGCCACTCGGCTTTTTCGCCGTTGAATCTGGCTGCGTCGACCAGGTCGGCCGACGAGCAGAACTTTGACGCGATGAAGGA
AGCTTACGACGCATGCATGGACACGGAAGCCATTGCCAAGGTTGGGATCTCTCCGATTCTGAAGCTGATCGACGACGTTG
CGGCGACGTTCAGCAGCGATGGAGACTACTCCGGAGCGATGCTGTATCTGCAAAAGGTGGGCGTCGGTGCGTTCTTTAAT
TTTGGAGTCAGCGAGGACGAAAAGGAGCCAGAGACGCAGACAATCAGCGTGAGCCCGATGGTGAGCGTGGGGCTACCATC
CAAGTCGCACTTTAAGGACAAGCAAATTGTGGCCAAGTACCAGGAGGCTATGGCCAAGGTACTGGGCGCGCTCAATCCCA
AGGTGGCGACGATCGGAGCAGGAACAGAGGCGGCTGCGGCGCTGGTTAAGCTCGAGTCCCGGCTGGTAGCGGCAGCACCG
GAGCCTCAGGACATGTTCGACGTGACAAAGACGTACAACATGATGTCGGTGGGGGCAACGGCCAAGCTGGTGCCACAGTT
TGGGCTCAAGGGCATGCTGAAGGCGCTCGTGCCGAAGGACTACGCTCTCAACACGACGATCACGGCGTTTCCCGACATTC
TGGCCAACGTGTCGAGGATTGTGGCGGACACGCCAGCCGAGGTGGTGCACAACTTCTTCTACTGGCGACTGATCACGTCG
TTTAGCGGAGCGGTGTTGGGGCCGGAGATCCAGCCGCTGCTGCAGTTCCAGAACGTGCTGCAAGGCAAGGACGCGAACGC
GGAGCCGGAGCGGTGGCGGACGTGCGTCCGGAGCGTGGGCAGCTCGGTGGGCTGGGTGCTCAGCCGGTTCTACGTGGAGG
TGGCGTTCTCGGCAGCAGCCAAGGAGTTTGGCAACCAGATCATCTCGGACATCAAGGCAGCGTACCTGCGCAACTTTGCT
GGGCTCTCATGGATGGACGACGAGGTTAAGACGGTGGCGGCCGAAAAGGTGCACAACATCGACCAGAAGGTGGGCTACCC
AAGCGCGTCACCAAACATCATGGACGCGGCGGAGCTGCAGGCATACTACGCGACGCTGAAGATCAGCGGGTCGCACTTTG
GCAACGTGGTGTCGGCGCGGCGGTTTGACGGGCGGGAGGAGTGGTCGGCGCTAGGCCGGGCGACGGACATGCAGCGATGG
GGGATGACGGCGGCGACGGTGAACGCGTACTACAACCCACCGCACAATGAGATTGTGTTCCCGGCGGCGATCATGCAGTT
TCCGCTGTTCGGGGTGGACCTGCCGAGTTACGTGAGCTACGGGGCGTTTGGAGCGGTGGCAGGTCACGAGCTCTCGCACG
CATTTGACAACAACGGGCGGCACTACGACCTGCACGGGCGGTACAGCAACTGGTGGACGAACGGGACGATTGCAGCATTC
CAGGCGCGGGCGCAGTGTCTGGTGGAGGAGTTTAGCAACTTCACGGTCGAGGGCAAGGACGGACCGGTGCACATCAACGG
CGAGCAGACGCTGGGCGAGAACATTGCGGACTCGGGCGGGCTGACGGCGGCGTGGTCGGCGTGGCATGCGCGGCGGAGCA
CGACCAAGGCCGGTCTAGAGCTCTCGCTGCCGGGACTGGAGCACTTTACGCACGAGCAGCTGTTTTACGTGTCGTTTGGC
AATGCGTGGTGCAGCAAGTGGCGGCCGGCTATGCTGACCAACCGGGTGGTGACAGACGAGCACTCGCCGGATGCCGTGCG
GATCAAGGGCACCGTGGCCAACTCGCGGGGTTTCCGGGAGGCGTTTCAGTGTCCGGTGAAGGAGCCGACGTGTGAGTTAT
GGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62