GenePrediction:GLEAN_587 Details

Name: GLEAN_587
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:753350..754356 (+ strand)
Length: 1007
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:753350..753461 (+ strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_97:753533..754356 (+ strand)
Length: 824
>GLEAN_587 class=GenePrediction position=GCSC_97:753350..754356 (+ strand)
ATGGCACCCACAGCAGCAGCGAGCGAGGCGGTCGTTATCAGCCAGAAGGCGGAGCCGGTCGAGAAGGAGCTGACGCCACT
ACAGGCCATCTCACACGGCGATGTGCTGCCAGGTGAGGAGAGGCGAGAGCGAGAGATGGATTTGTGGCTGTTTATAGTAA
TACCAATGCTGATGACGGCTCAGACATCCCGACTTTTGTGTCATTTGCGGCCGAGCGACGCCACATTCTGATCCACATGG
CGGCGACGTTTCGGCATTGGGCGCGGCAGAACTTCACCGAGGGCCAGAGCGGCCACATCTCGGTGCGCGATCCCGAATTT
CCCGGCATGATGTGGATGAACCCGCTGTCGCGCCACTTTGGCATGCTGACGGCGGGCGACATGCTGCTGCTGGACATTGA
GACGGGCCACATAGCGGCCGGCAGCCCGAACCCGGCAACCGGCCTGCGGACGTCCAACCGGGCCGGCTTCTTCATCCACC
GCGCCGTTCATCGGGCGCGGCCACACGACGTGCACTCAGTCTGCCACGCGCACACGAACAGCGGCCGGGCCTGGGCTGCG
TTTGGCCGACCACTCGAGATGCTGACCCAGGACGTGTGCACGCTCTATGGCGCCCATGCCGTCTACAACCAGTACGGCGG
CATCGTGTTCGGCACCGACGAGGGCGAGCGCATTGCCCACGCGCTCGGAACCTCGAACAAGGCTGCCATCCTGATGAGCC
ACGGGCTGCTGACGGTCGGCAGCACCGTCGACGAGGCCGGTTTTCTCTTCGGCCTCATGGACCGCTCGTGCGATATCCAG
CTGCGCGTCGAGGCCGCCGCCGCTGCCGGCACGCTCAAGAAGCAGATCATCAGCGACGACGAGGCCGCCTACAACTTCCG
CATGGCCAGCGAGCCCCATGTGCTCTACCGCGAGGCCCAGGCTGACCTTGAGCTCGAGATCGAGGCTGCCGGCGGCGAGG
AGGCCCTGGCCAAGGGTCTCGACCAGCTCGTCATCATCCGCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62