GenePrediction:GLEAN_5882 Details

Name: GLEAN_5882
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:372839..369829 (- strand)
Length: 3011
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:372839..372736 (- strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_173:372271..371975 (- strand)
Length: 297
Type: CDS
Source: GLEAN
Position: GCSC_173:371833..369829 (- strand)
Length: 2005
>GLEAN_5882 class=GenePrediction position=GCSC_173:372839..369829 (- strand)
ATGTCCTCGTACAGCTACTCGATAACGGGCGGCCCTGCGCCGTCCACTTCATCACGTAATATCATCAAGAAGTTAAAGCA
GCGGCAAAAAAACCAATATGACAGGTAGGTTCAGACACAATCGTTCATCTCCAAGCCTCTTCAAGTCTGCTGGTGTCTCG
CCGTTTGCTGTCCAGTGACAAAAGTGGGGTCGTACCTGCGCCATCCGGCGCGCCTTCCTCTTTAGCGTTCTCCCCCACTA
TAACGGCAGGATCCCCACTAAGTCTCTCCTGGCGTTATTGCTTGTGTCTCGGCGCATTCCTGATACGGCTTCACATCTCT
GGCCCTTAGCTCTCCCCTCCCCCCTTTCTTTTCTCTATCAATATCATCCACACATAGCGAAACGGTGGGATCGTGCTGTG
TGCATCTGTGGTTCAGCCTTATACCTTATATCCTTTGCTCCTCTTCTTTTTGCTATTTGTGCAGGCACATTTTCTACGAC
CAGCGTTGTACGCCTCTTTTTTTGCCACTAAACTCGACGTTACATGACATCTCGCTTGATCGTCGATTGACCCAGACTCA
TCTTATAGGGAATCGTCGCGCCCCAAGGCTTCTCTCGAGACTTCTTCCTCTCTGCAACCAGACCAGATTTCGCTCCGCAC
TGCTTCGTCCGTATATTCGCAGCCCAGTCCGCTGGACAACACGTTCGACGCGTCGCAGACGAATGATCACCAGACACCAT
CGCAACAGTCATATCAGCAGCCATATCAGCAACAGTACCAACACCAGACACGAAACTACCTCCGATCTCGGGAAGGCTCA
CAAAAAGCGGACGAGGTATCTCCTCCGAGCTCCCCAGAGATCCTTCCAACACAGCTCCCATATAGGTAAGATACGATTAA
ATCAATGTACCCCACCGATAAGCTGGGGCGGACATTTTCTGTTCCCCTCCATTGTTGCGTGATGCAATCTGCTTTCATTG
GTACTTTGGCGTATGTTGTAGTCGACTGACCTGACCTCGTGAGCAGATTCGATGACCGGCCCTTTTTACCTTGCATAGAC
AGAGAACCGCCCTTGACCATGGCGCAAACCGAGCTCTCGCACGATTCTGGCCAGGACGGCCGTAAGTCTTCACGGTCAAA
CATCCCAACGATGCGCCGTGAACGAAGGCAGAATCAGGAGGCGGCAGCCCGCAGTCTGCGAGTCGCACAGTCAAAAGAAC
GGTTGCAGACACCAACCAAGCAATTGCGCCCGAATTCGAGCGCCTCTTCCAAACGGGGATACAAAGGCGGAGAGGTTCGC
TGGGACCCCAATACGGGCGAGCTCACTAGCTCCGACAAAGGCCGTCCCAGCCAGGTGAAGCCGGCCGAGTATGTACGCGG
CTTGCTTACACCCGGACATGACGAATCTGGAAGTGTGACTGACGATCCCGCATCCGCAACGAAGACGGCGGGATCGTCCG
GCCTGGCCAGCTTTGCCAGCCGGCTTCGTCGGACAGTGCAGAATGGGGCTGCCCACATGGGAGGTGGGAAGGCCCCAGAG
ACAGATGTTGAAGGTACTCGCCAGTCATCACTGCCCTTGTCTCCTGCATCTTTACCGCCAAGGGCTTCGCCAGCCAGAGA
CCTTTCTACGTCGACGGACCCTGCAGCCACTGCTCTCACTTCTAATCGCCCAGCCTGGAACGGCGCCAGCGGTAGGACAA
CATTGGTGGCCCCTGTTACCGATACCAGAGAAGTGCCACCGCTCAATATCCCACAAAAGAGTAGCAGGCGAGTAGGCTCG
TCACCAAGACTCGACGCGGGTGTCGCCGATCGTTTGTTGGCCGTTCAAAACAAGCAGAGTCTGGCAAGCCCACCTGTCAG
CCCTCCGAGTCAAAACTCGATCCTCCCAGAGCCTGTCTTTGACGCTCCATTCCTTATCCAGGAGGGCACACGGCCAGCAA
CCCCTCCTCATGATACAATTCAGACGCCGCCGCCAGCAAGCCGTACAGCTTCTGCCCTAAGCTACCCGAGCCCTCCGCCA
TCAACAGATGTACCGAAAATGGGCCCAGCGCCGGTACAGCAACGGGTATCCCAGATCAAGAGAAAGCCAGCTCCCGCTAG
AGACATGGGCAGCTACGATGACAATGATCCTTTCAATTATAACAACAAGCCACGGGCAATGTCCTCGAAGTCCACGGGAG
CTGAGCCGGACTGGACGCAACCGCCTTCGCGCTTCAGTGCGACCACTTATAGCTCATCACTGAATGAATCCATGTACGAA
CCAGACGCAAAGGATGCCCCGGAGATGCCGCCCATACCCGACAGCTTCCGGTCAAGACAACCAACAGAAAGTGAAGACTT
CAGAGACGACAATCCGTCGACCCGCCGACCACGGCCAGCACCTATTGTCATCGAGCCTTTGGCGGTCAAGAAGCCTTCAG
ACAGTGTCATGGATCGACGCCGCCCGCTATGTATGGGCCATGCGAGCCCGAGATCCTTGAAGGACGGCACTGAGCCTGTC
GTGATCAGTCTGAATACATCTTGGAAGAGCGGCAATAAGCCAAGCCTCCGCGACGCGGATAGCAGCGGTTATGTGAGCAG
CAGCAGCAGCGGAGGAGAAGACCGGCTCAGTCCCATGCCAGGCCAGTTCCGGCTGCACGTGGTAGAGTCTATACTGAAAC
CTACACGCACGACAGAGGCTGGCTCTGTGCACAAAGATCTTCCCCCTGCGCCGCCAGAGACAACTGCCAAGGACCGGATT
ACAATGTTGAACGCACAGCTGGCAGATCTGGCACAGCGGCGTTTCAATGTCGACCGCAGCATAAAACAAATGACCCAGCT
GATGCCGACGGACAACATACTTGCAAGCACACAAGTCCTGCTCAAACGGGAGCAGGAAAAGAGCAAGGTAGAAGGACTCC
GCATGGAGCTATCCGAGATTCAGCGAGAAGAATACGAGATCGGCCTGAGACTGCACCGGGCTTACAAGCGGTTAGACCAC
AACGCCGAGTATGAACCGACTACGCTCTGGGTTCGGAGGGTTACGGGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62