GenePrediction:GLEAN_5883 Details

Name: GLEAN_5883
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:364230..361937 (- strand)
Length: 2294
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:364230..364161 (- strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_173:364083..364064 (- strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_173:363983..363883 (- strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_173:363820..363590 (- strand)
Length: 231
Type: CDS
Source: GLEAN
Position: GCSC_173:363536..362895 (- strand)
Length: 642
Type: CDS
Source: GLEAN
Position: GCSC_173:362832..362380 (- strand)
Length: 453
Type: CDS
Source: GLEAN
Position: GCSC_173:362296..362071 (- strand)
Length: 226
Type: CDS
Source: GLEAN
Position: GCSC_173:361954..361937 (- strand)
Length: 18
>GLEAN_5883 class=GenePrediction position=GCSC_173:364230..361937 (- strand)
ATGCCGCGCTCCAGCTTCTCGGATAACCCCCTGCTGCGGGTGTCGCGGCCAGTGTCTGCCTGCTCGCGATGTAAGTTTCA
GCCTCCTAGCTCGGGCAGCTCCGAGCCCTTTGCCTTTGCTCTGGCTGACAGCAGACGACGACGACAGGCCGAGCTGCCAA
AGTAAAGGTGGGCTACCTGCTACTGTCGCCATGTCGGCCGAAGGGCCAGTCTGCCTCGTGTCCACTACTGACACCGTTTG
CTCGCAGTGCGATGGCAAGCTTCCCGCATGTACGGCCTGTGAAAAGGCTGGGCGCGAGAGCGACTGCTCTGCTGCCAATG
ACCAGTTTGCTCGTGGCAAAGAACGAAGGTATTTCGCTTCCTCTTGTCGCTCTGTCCCCGGTCGGGTTTCGTGATTACTG
ACCCTGACAGTTATGTGGCTGCATTGGAGCTCCGAGTCGAGAAGCTTGAGCGCCGCCTTACCTTTGCCCGATCTCGCACT
GCCTCTGTCGCACAGATCGAAAGCGATTCTTCACTCATGACGCACTATGGCAACGATCGCAAGGACTCGCTTGCTTTTAT
TCGAGCCGCCATTCACCGTAAAGCCCTCAGGAAGCGCCAGCTCTCCGATGTCAACTCGCTGGTTTCCGACTTTGGCTACC
TGTAAGTATTTTCGCACTTCCGTTGTATCTTACGCTGACAGCCGTCCCAATCAGTTCCGTCAATGCCACCACTCGCGACT
TCGAGCCGTCTGTCAGCAACATGACCTTTGCTAGGCTCGTGTTGGCTACGACGGTCAATGATCCGCTACCAGAGGCACCT
CAGATGTCGTCCAGAATTCCCTTGCGCCAAACTGCCATTGAACTTGTCCAGCACTATCTCGGACACATCCACATTCTTTT
GCCCTTCTTCGCCGAAACCACCATTCTGGCTCACCTCGAAGAGCTGTATCATCAGCACCACACCGGCGCGGCGCAGCCCC
CGCAGCTTCGTCCCAACCTGCGCGATGCCGACTACTGGTTGTTTTACATGGTGCTTGCCATCAGCTCGGCCTTTCAGAGC
TGCAGCTGCCAGGACAGCTTCTACGCCAATGGAGTGGACTTTGCGGCGCAGGCAATGCGCTATGCTGACGGCGCCCTTGC
TCCTGGTCGCAGCACACAGGTCCAGTCGTTGCTGCTGCTGACCATGTATTCCATGCTCGATCCAGCCCACTTCGACAGCT
GGCATCTCATTGGCATAACCTGCCGTGCCATTGTCGATCTCGGCTTCCACCAGGATCCTCCGCGCTCACAGAATATGGAT
GCAACAACGTTGGACGCGCGGCGCTGTACCTTTTACTGTGCATATGCCCTTGATCGGTAAGCCTCTCTCTCTGCACCTGT
CTGGCTGTGTTGGTAACTGATCGTGTATCATTTGGCAGCACTATAAGCATGGTGAATGCTCGCGCTTTCTCCTTCACGGA
CGACGGCATTAATGTTGCCTTTCCGTCCATGATCGGGCGCAATTATCCACGGCCTCGACCACACTTGAACCCGTCTGGGC
CCGGTCCTCGACTTCCGGCACAGTCGGTGGCGCTAAACCATATGCCTTTATCCCCCTCGTCACTGGGACCGCCCACAAGT
CCGGCGTTGTTGATATTCCAGCTACGGAGAGCTCAATCCCACTGGTATCAGATGCTGTACCAGTCCGATCCAAAAGAGCC
GCTGGCTGACCCGACGGCTTTTGTATGGCGCATGTGCGCCGACATGCGGGAGTGGGCCGAAGCTCTCCCGGTTGGCCTCC
CGGCAAACCTTCGCGATTCACTCGATCTGGAGCTACAGTACAGCTACGTGTACTGCATAGCTCCAAGCACACGTGCACCG
TTGGTGACGACGTATGGACGCATGCTTTATTTTTTGAGCACGTCATTGCGTACGTGGACCTCACCATGCCTGAATCGACA
CATGCCCTCTTGAGCGTGGCCTGGCGGACATATCATGATGCCCTGCGGGTGTTTTTCATGGGCAGCCAGTTCGTTGCCGT
GCTGCGCGATGCTTCGGCCGCTGATGCCATTCTGGCAGGCGGGGGATCCGTTCCAGTGCCATTGGCCCTACCGGGTGAAG
CACCTCCGCCACCGATGCCGAAAGCCGGTATGCGGAACCAGGGCCTCGGCGGGGGAGGACGGAACGGTGGCATCTACCCT
GTGTCTAACACGGAGCGTGCTATCTCATGCATAGAGCGTGTTGGCTGGATTTTGACGACGTTGGGAAACAGGTGGGAATT
AGCCGAACAATTGGCGAATAACTTCAAGACGATCAGCCAGGCCGTTATGGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62