GenePrediction:GLEAN_5884 Details

Name: GLEAN_5884
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:358105..356967 (- strand)
Length: 1139
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:358105..358006 (- strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_173:357940..356967 (- strand)
Length: 974
>GLEAN_5884 class=GenePrediction position=GCSC_173:358105..356967 (- strand)
ATGGGCAGTCTTGCAGAGGACGTCGTCGTCAACCCGATCCATCCTTCGGTCGAGGGCATGCTCAGCGAGCAGACCAAGAA
CATCTACAACCAGTACCAGTGTAAGTTTGCGTCGGATGTCGGCTTGTCGATGGCATGATCGTCCGTCTTTTTGTCTGACC
GTCAGCTCGCCGACTGCGTGCCGACCAGGTCCGCTTTGCCGACTACGACCTCGACCGGGCGCGGTATGCGTTCCCGCGCG
CCGAGGTGGCCTCGCCGTTCTGTCCGGTCGGCGAGACGACGGTGCACCGGGTGCCGGTGACGGAGCCGGCTGGCGAGATC
GAGCTGCAGATCTATCGGCCGACGAGCGCGACCCCAGGCGCCCTGCTGCCGCTCTACGTCGACTATCACGGCGGCGGCTT
CGTGCTCGGCAGCCTGGCCGATGATGACCCGCTCTGTCGGCAAGTCTGTCAAGGTGCTGGCTGCATCGTCGCCAACGTCG
CCTACCGGCTCGCACCCGAGTTTCCGCACCCGGTCCCCACCACCGACAGCTGGACGGCCCTCTGCTGGCTCGTGGCCCAT
GCTGCCGACCTCGGCGTCGACCCAAGCCGCATCGCCATCGGTGGACTCTCGGCCGGTGGCTGCATCGCTGCCTCTCTTGC
CCAGATGGCCCGCGATGATGTCACCATGCCGCCCCTTCGCCTGCAGGCCCTCATCGTTCCCGTGCTCGATGCCCGCTATA
TGCCCGTCGTCGGGGGGTTTGCCGAGACCGGATCCACGTCTTCGAAACCCCCCTACGACTCTTACCTCTCCTGCGAGTTC
GCCCCGATGCTGCCCATCGCCCGTCTCGTCTGGTTCTACAACCTCTGGCTCGGCACTGGCCCCGATCGCGATCAGCGCGC
CGCCGACGTCCGCGCCTCGCCCATCACCGCTCCCTCTCTCTCTGGCCTCGCGCCCGCCTCCTTCCACGTCGCCGAGGTCG
ACCCGCTCCGCTCAGAGGCCGTCGCCTATCACGACCTCCTCCTCAATGCCGGCGTTCCCAGCCAGTTTCACCTCTACAAG
GGCACCTGCCATCCCTTTGGCCAGTGGGACGGCAAGCTCGATGCCGGCAAGGAGTTTATCCGCGATCTGAGCGAGGCCCT
GAAAGTGGCTTTCAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62