GenePrediction:GLEAN_5887 Details

Name: GLEAN_5887
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:331222..329151 (- strand)
Length: 2072
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:331222..330947 (- strand)
Length: 276
Type: CDS
Source: GLEAN
Position: GCSC_173:330883..330762 (- strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_173:330314..330187 (- strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_173:330124..329151 (- strand)
Length: 974
>GLEAN_5887 class=GenePrediction position=GCSC_173:331222..329151 (- strand)
ATGCAAGCCACTAGGAGGCTGGACACGCTCCTAAGGGAATACGTGGCAATCAAGTTTGACGTCATAGTTCCTGAAAGCTC
GTGGGATTCAGTCTTGGACAAGCTCAATGAAGCCGAAAGCGGGCTGAAAAGGAAAGATAATGACGTCAAGCAGCTCTTCA
AGAAAGTATTGGTGAAGCTGGGCGACAACGCCACTGAGATTCAGCCATTTGTCGACCTCATTCCCAACGAATATGGACTG
AGTGTTGTCAAAGCTGGCATAGCCCTGGTGCTTGAAGTTCGTTAGACTAAAAGACAATGCCAACAAGAAACCCGTTTTCG
ATCACTAACACATATCAAGTACGCTTCAAAGGAGAGCGATAAAAAAGAAAAGATCTATGATGCTTTTGCAGAGGTTCGCG
ACACTGTTGCAGATGCACGGTCCTTCGGGCAGAGCTTTCAGGCGAATACCGACGTCAGCAGGTGCGCTGCTGATTTGTAC
GATGCCATTGTGCACACGGTTGAAGACCTGTTCCGATACGTGCCAACGGAAGTGCCCAAAGATTTCAAAGGACGAGACAG
ATGCACGTTGTCCAAGCCTATTGACGTCCTGACTCAAAGCGCTAATGTCTGATTGCTTGCAGGGAATCCGCTTGCTCTTA
AATCTAAACGCAAAGAGAAGCTTCCCGATATAGACACCGTTCTAAGAGATTTAAAGCAAAAGGCAAAGAACTTGAAGCGG
CAGGTAGAAGGCTGCGCCTACGACAGGGCTGGACACACTCATGCGGCCGTGAGAAGTGTTGAGGCTTCATTGACACAGGT
TCGCCAAGGTGTGAACAAGGCATATGTTGCGGCTTCGAATGCGGAAAAAGAGATAGTCATTGTCAGAGAAAAAGTCGTCT
CAATAGAGGCCACCACACAGCAACTTAGTCGGCAATTGAAGGAGCAAAAAAAGAGAGAAGAAGAGAAGCACGATGAGGCC
ATGCGGCGAGTGGGAGAATTCATTATGGGAAACCGCTTGGATGCAAATAATGGCTTGGTGATGGTGCTCAATGAGAGTAA
GTGCAATTTGCATCCACCAGAACAGTATAGGGATGCCGCTGACAGTGACGTCACACAGGATGTGCTGCCGTGTTAGCCAC
CGTAGAGAGGCTCGAAAATCAACTCAAGTTTCGATCAAACGGCTCTCCACCCATGGCGGTGTCTCCTGGTCGGCTGCTCG
AAAAGTTTGTGTCAGCGGTTGCTAACGGCGCCCAGACGACCGGTGTAGATGATTTGATTCTGCACCCTAACAACGACCTG
AAGTCTATCATCGCACGCAAAGGTCATTTTGATGTTGGGATGCAAGCCCAGGCACAGTCACTATTGAAGAACCCAAGGTT
TTCTGAGTGGATGAGGTGTTCGCATTCTGACCTGCTGCTCGTGGATGGCAACAGCAATTTTCCTGCATCTGGAAACTTCT
CTGCACTCTCGCTTCTCTGCGCTACACTGGTCGCAAACATGACCGTAACGTACTCAGATGACCTAGTGATCAGCTTCTTC
TGCGGCTTTCACAGTGCCTGCCTCGACCCCTGGTTCGGGCCCATCGGGCTGGTGCGCTCACTCATATTGCAGGTCCTACT
GTTCTTGGAGCAGGAAGAGAAGAGGGTGGGCTACGACATTAGGATCGAGAAACCAGACGCGTACCTCGACAGTTTTCTGT
CGAGTCGACCGGAGACGGTTGCCGAGGTCTTACATTGCCTTCTCCAACACATCCCGCAGGCAGACCTGACGTTCTATTGC
ATCATCGACTGCGTATCGTGTTTCGACAAGGACCTTCACGGACAGTACAACAATATGAAAGTTGTTGTGAGCTGGCTGCA
ATACATGGCTGGGGAAGACGACAGCATGCACGTCCATTTCAAAGTCCTACTTACAAATCCCGGGAGAAGCACTGGAAGAA
TCAGCAGCTTGGTTGATACGACGCAGCACATCACTTTGACATCGAACCCCTCCAGCATTCAGACAATCTCAGATCGATCA
GTGGCAGCTCATATTTTGTCTTTTTCTGCTGCAGGTTCGAACCAAAAGCGTTTTGAAGACGAATGGGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62